ID: 1030105244

View in Genome Browser
Species Human (GRCh38)
Location 7:105981785-105981807
Sequence TAGGAGAAGCAGATTTGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 347
Summary {0: 1, 1: 0, 2: 6, 3: 40, 4: 300}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030105244_1030105248 -6 Left 1030105244 7:105981785-105981807 CCCACCCAAATCTGCTTCTCCTA 0: 1
1: 0
2: 6
3: 40
4: 300
Right 1030105248 7:105981802-105981824 CTCCTATATCTTTCCCATTTTGG 0: 1
1: 0
2: 0
3: 13
4: 222
1030105244_1030105252 26 Left 1030105244 7:105981785-105981807 CCCACCCAAATCTGCTTCTCCTA 0: 1
1: 0
2: 6
3: 40
4: 300
Right 1030105252 7:105981834-105981856 ACTCCATCCTTCCTGTTGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030105244 Original CRISPR TAGGAGAAGCAGATTTGGGT GGG (reversed) Intronic
901329345 1:8393035-8393057 TAGGAGAAGGAGAATGTGGTGGG + Intronic
901368429 1:8774840-8774862 AAGGAAAAGCAGATGAGGGTTGG - Intronic
901658701 1:10785568-10785590 GAGGAGAAGCAGAGGTGGGGTGG - Intronic
902764833 1:18607182-18607204 TAGGAGAAGCTGCTGTGGGCAGG - Intergenic
903978313 1:27166703-27166725 TGGGAGAAGCAGGTTTGGGGAGG - Intronic
904010052 1:27384075-27384097 TAGGAGAAGCAGATGGGGGAAGG - Intergenic
904465485 1:30704929-30704951 TGGGAGCAGCAGGCTTGGGTGGG - Intergenic
904843771 1:33392658-33392680 TAGGACAATCTGCTTTGGGTTGG - Intronic
905107124 1:35570622-35570644 AAGGAGAAGCAGGTTGGGGTTGG + Intergenic
905328238 1:37173817-37173839 TAGGTGGAGCAGACTTAGGTGGG + Intergenic
906196874 1:43935078-43935100 GAGGTGAAGCAGCTCTGGGTGGG + Intronic
906527312 1:46502268-46502290 TTGGAGAAGCAGATCTGAGGAGG - Intergenic
908226361 1:62059973-62059995 GAGGAAGAGCAGATTTGTGTGGG + Intronic
909016275 1:70383167-70383189 TGGTAGAACCAGGTTTGGGTTGG + Intronic
911455661 1:98119937-98119959 CAGGAGAACCATATTTTGGTGGG + Intergenic
912950765 1:114118757-114118779 GAGGAGAGGCAGATGGGGGTGGG - Intronic
913439048 1:118878044-118878066 TAGGAAAAGCAGATTGAGATTGG + Intergenic
915349446 1:155215239-155215261 TGGGAGAGGCAGCTGTGGGTAGG + Intergenic
915352644 1:155235921-155235943 TGGGAGAGGCAGCTGTGGGTAGG + Intronic
915790669 1:158666852-158666874 TAGGAGAAGCATAATGAGGTTGG + Intronic
916095488 1:161346098-161346120 TAAAAGACGCAGATTTGGCTGGG - Intronic
916344464 1:163772240-163772262 GAAGAGAAGCAGATTGGGGAGGG + Intergenic
916595036 1:166235334-166235356 TATGAGAGGCAGAGTTGGGCAGG + Intergenic
916797512 1:168180328-168180350 GAGGAGAAGCAGATGGGGGCAGG + Intronic
917668954 1:177253922-177253944 TATGATGAGCAGATTTGGGATGG + Intronic
918009386 1:180572451-180572473 GAGGAGGAGCAGGTTTGGGACGG - Intergenic
920207845 1:204306144-204306166 TTTGAAAAGCAGATTTGGGGTGG - Intronic
920724307 1:208419508-208419530 TTGGGGAAGCAGATGGGGGTGGG - Intergenic
920870245 1:209788172-209788194 TAGTAGAAGGAGATTTGGCCTGG - Exonic
920983060 1:210856404-210856426 TGGGAGAAACAGTTTTGGGGTGG - Intronic
922874045 1:228925997-228926019 TAGGAGAATCAGATTTTGATGGG - Intergenic
923219818 1:231882934-231882956 TAGGAGAAGAAGGAATGGGTGGG + Intronic
924292958 1:242556691-242556713 TAGAAAAAGCAGATTTTGGAGGG + Intergenic
1063821521 10:9841973-9841995 TGGGAGAAGCAGAATTGCGGTGG - Intergenic
1065177620 10:23095227-23095249 TGGGAGATGCAGAGATGGGTTGG + Intergenic
1067556484 10:47276835-47276857 GAGGAGGAGCAGATGTGGGAGGG - Intergenic
1068229233 10:54149538-54149560 TAAGAAAAGCAGAGTTGAGTAGG + Intronic
1069042894 10:63712949-63712971 TTGGAGAACCAGATCTGGGGTGG - Intergenic
1070852845 10:79582170-79582192 TAGGAGATGGGGATTTGGGGAGG - Intergenic
1070982166 10:80657748-80657770 TAGGAGAGGCAGATGCAGGTTGG - Intergenic
1072252177 10:93590385-93590407 TTGCATAATCAGATTTGGGTGGG - Intronic
1073012848 10:100374709-100374731 TAGAATAAGAAGATTTGGGCAGG + Intergenic
1073153622 10:101329018-101329040 TTGAAGAAGCAGGTTTGGTTTGG - Intergenic
1074389508 10:113045080-113045102 GAGGAGGAGCAGGTTTGGGGTGG + Intronic
1074548482 10:114421024-114421046 GAGGAGGAGCAGATTTGGGGTGG - Intergenic
1074584802 10:114757445-114757467 TAGAAGGGGCAGATTTGGGGAGG - Intergenic
1074616982 10:115079359-115079381 TGGGAGAAGCAGGTTTGGGAGGG - Intergenic
1075001162 10:118799140-118799162 TAGAAGGAGCAGCTGTGGGTTGG + Intergenic
1077864704 11:6212379-6212401 TAGGAGCAGAGGATGTGGGTTGG - Intronic
1078705587 11:13740800-13740822 TAGGGGAAGGAGGTTAGGGTGGG - Intergenic
1078858777 11:15228333-15228355 TAGGAAAAGGAGATCAGGGTAGG + Intronic
1079301834 11:19285379-19285401 AAGAAGATGCAGATTTGGGCCGG + Intergenic
1080689554 11:34545049-34545071 GAGGAGGAGCAGGTTTGGGTGGG + Intergenic
1080693741 11:34582795-34582817 TAGCAGAAGCAGAGTCGAGTAGG + Intergenic
1080979747 11:37387229-37387251 AAGGAGGAGCAGCTTTGGATGGG - Intergenic
1083160213 11:60849907-60849929 TGGGAGAAGGGGATTTGAGTCGG - Intronic
1083952200 11:65962965-65962987 GAAGAGAAGCAGATTTGGAGCGG + Intronic
1086208153 11:84285220-84285242 AAAGAGAAGCAGATTTGAGGAGG - Intronic
1087946741 11:104170600-104170622 TGGGAGTAGGAGATTTGGGGTGG + Intergenic
1088055477 11:105571287-105571309 CGGGAGAAGTAGATTTGGGTGGG + Intergenic
1088122244 11:106384166-106384188 TAGGGGAATCAGATTAGGATGGG - Intergenic
1088802303 11:113317321-113317343 TAGGAGAAGCAGGTTTTATTTGG - Intronic
1088866267 11:113850960-113850982 TAGGTGGAGCAGATTTGAGATGG - Intronic
1089850450 11:121491542-121491564 TAGGTGGAGCTGATTTGGGGTGG - Intronic
1090057421 11:123435243-123435265 TTGGAGCAGGAGATTTGGGGTGG - Intronic
1091822810 12:3489341-3489363 AAGCAGAAGCAGTGTTGGGTGGG + Intronic
1092888082 12:12942846-12942868 TAGGAGAAGCGCATTGGCGTTGG + Intronic
1095307281 12:40653010-40653032 TAGGAGAAGCAGGTTGGGGCAGG - Intergenic
1095724964 12:45441588-45441610 TAGGAGAATGAGGTTGGGGTGGG + Intergenic
1096095111 12:48929618-48929640 TTGGAAAAGCAGATTAGGGCTGG - Intronic
1096354504 12:50928891-50928913 GAGGAGAGGCAGGTTTGGGGAGG - Intronic
1097135202 12:56847214-56847236 TTGGAGATGAAGATTTGGGTGGG + Intergenic
1097159953 12:57039034-57039056 TCGGAGGACCAGATTTAGGTTGG - Intronic
1097388333 12:58978232-58978254 TAGCAGAACCTGATTTAGGTGGG - Intergenic
1097655987 12:62363919-62363941 TAGGAGAAGTAAATTTGGGGTGG + Intronic
1098397654 12:70038828-70038850 TAGGAGGAGGATATTTGGGAAGG + Intergenic
1098693498 12:73521375-73521397 TAGGAGAAGCACATCTGGAATGG + Intergenic
1100532371 12:95472540-95472562 TTGGAGAAGTAGATATGGCTGGG + Intergenic
1100592655 12:96043944-96043966 TGGGAGAAGCAGACTGGAGTGGG + Intergenic
1100651775 12:96597906-96597928 TGGGAGAGGCTGATTAGGGTGGG + Intronic
1101671902 12:106883490-106883512 TAGGAGATGGAGATTTGGTGGGG - Intronic
1102095913 12:110241252-110241274 AGGGAGAAGCAGACTTAGGTAGG + Intergenic
1104038416 12:125114327-125114349 TGGGAGAAGCAGACTTTGGAGGG - Intronic
1104357512 12:128100956-128100978 TAGGGGCAGCAGAGCTGGGTGGG + Intergenic
1105248994 13:18679083-18679105 GAGCAGAAGCAAATTTGGGGAGG + Intergenic
1106290126 13:28353275-28353297 TAAGAGTATCAGATTTGGCTGGG + Intronic
1106785090 13:33099517-33099539 GAGGAGAAGCAGATTCGTGGGGG - Intergenic
1106814853 13:33396290-33396312 GAGGAGAAGCACATCTTGGTTGG - Intergenic
1107679540 13:42834245-42834267 GAGGGGAAGCTGATTTGGGAGGG - Intergenic
1108544740 13:51481559-51481581 GAGGAAAGGCAGAGTTGGGTAGG - Intergenic
1108903519 13:55442743-55442765 AATGAGAAACAGATTGGGGTGGG + Intergenic
1110260375 13:73477790-73477812 TTGGAGGAGCAGATTGGGATAGG - Intergenic
1110629713 13:77694231-77694253 TATGAGTAGTAGAGTTGGGTGGG + Intergenic
1110684028 13:78350728-78350750 TAGGGGAAGCAGCTTTGAGAAGG + Intergenic
1110776303 13:79411928-79411950 GGGGGGAAGCAGAATTGGGTGGG - Intergenic
1110851916 13:80256111-80256133 TAGGAGGAGCAGGTTTTGGTGGG - Intergenic
1111707743 13:91772075-91772097 TATGAGAATCAGATTGGGCTCGG - Intronic
1112467190 13:99654463-99654485 TGGGAGAAGAAGATTTGGGTTGG - Intronic
1113532885 13:111042323-111042345 GAGGAAAAACAGATTTGGGAAGG - Intergenic
1115877717 14:37879408-37879430 TAGGAGAAGCAGAGTTGGGCTGG + Intronic
1116043983 14:39720514-39720536 TAGGTGAAGCATACTTGGGAAGG + Intergenic
1116305638 14:43251811-43251833 AAGGAAAAGCACATTTGGGAAGG - Intergenic
1116832817 14:49739099-49739121 TAACAGAACCAGTTTTGGGTGGG + Intronic
1117025801 14:51618723-51618745 TAGGAGAAACAGGTTTGGGTGGG + Intronic
1117967410 14:61220134-61220156 TTGTAGGAGCAGATTTGGTTTGG - Intronic
1117996538 14:61483321-61483343 GGGGAGAGGCAGAATTGGGTGGG - Intronic
1118037152 14:61880093-61880115 AAGCAGAAGCAGCTTTTGGTGGG - Intergenic
1118418971 14:65577745-65577767 TAGGAAAAGTAGATTGGGGTAGG + Intronic
1119891873 14:78189004-78189026 TGGGAGGAGCAGATTGGGGCAGG - Intergenic
1120147651 14:80996829-80996851 TGGGAGAAACAGATTTGGAGTGG - Intronic
1124939288 15:34203147-34203169 TGGGAGGAGCAGATTTGAGAGGG - Intronic
1126255277 15:46617972-46617994 GAAAAGAAGCAGAATTGGGTAGG + Intergenic
1126896359 15:53261236-53261258 TAGGAGAAGCAGACTGGTATAGG + Intergenic
1127026842 15:54815968-54815990 TAGGAGAAGGGGCTTTGGGGAGG - Intergenic
1127905078 15:63370474-63370496 TAGGAAAAGCATATCTGGGCGGG + Intronic
1128290518 15:66475062-66475084 TTGGGGAAGGAAATTTGGGTGGG + Intronic
1128552286 15:68606088-68606110 GCAGAGAAGCAGATTGGGGTGGG + Intronic
1129762297 15:78136909-78136931 CAGAAGAAGCAGATTTGTGGAGG - Intronic
1131342493 15:91615600-91615622 TGGGAGAAGCTGATTTGGGAAGG + Intergenic
1131653591 15:94429853-94429875 TAGGAAGAGCAGGTTTGGGGAGG - Intronic
1134914333 16:18057241-18057263 TAGGAAAAGCAGATTTTTTTGGG - Intergenic
1135420963 16:22305233-22305255 GGGGAGAAGCAGGTGTGGGTGGG + Intronic
1138303088 16:55948935-55948957 CAGAAGGAGCGGATTTGGGTGGG + Intronic
1138593075 16:58013218-58013240 CAGGAGAAGGAGTTTTGGTTGGG + Intronic
1138999771 16:62495351-62495373 TAGGATAAGAAGATTGGTGTAGG + Intergenic
1139130121 16:64132924-64132946 CAGGAGAAACACATTTGGCTTGG + Intergenic
1139417327 16:66824030-66824052 TAGGAGAAGCAGAATTGGCTGGG - Intronic
1139970294 16:70770112-70770134 AAGGAGGAGCAGGTGTGGGTGGG - Intronic
1140672190 16:77290360-77290382 TTGGGGGAGCAGATTTGGCTGGG + Intronic
1144647330 17:16984274-16984296 TAAGAAGAGCAGATTGGGGTGGG + Intergenic
1144831306 17:18132666-18132688 AAGGTGAAGGAGATTTGGGGAGG + Intronic
1146079984 17:29770767-29770789 TAGGAGAATAAGACTTGGGCCGG - Intronic
1146794697 17:35773110-35773132 TTGGAGAAGCAGTTTGGGGGTGG - Intronic
1146795503 17:35777440-35777462 TAGGTGAAGCAGAATTGGTTTGG + Intronic
1146983280 17:37186550-37186572 TAGGAGCACCAGAACTGGGTTGG + Intronic
1148253562 17:46107804-46107826 TAGTTGAAGCAGGTTTGGGATGG - Intronic
1149299316 17:55289450-55289472 TAGGAGAAGCAAATGTGAGGAGG - Intronic
1149473655 17:56940544-56940566 TAGGATCAGCAGATTTGGCCTGG - Intronic
1149600684 17:57891246-57891268 GGGGAGAAGCAGGTTGGGGTCGG - Intronic
1150793850 17:68222199-68222221 GGGGAGAAACAGACTTGGGTGGG + Intergenic
1154439884 18:14380146-14380168 GAGCAGAAGCAAATTTGGGGAGG - Intergenic
1155449819 18:25951827-25951849 AAGGAGTAGCAGAAGTGGGTAGG - Intergenic
1156397974 18:36716457-36716479 CAGGAGAAGCAGTTTAGGTTGGG + Intronic
1157718902 18:49908294-49908316 TAGAGGAAGCAGATCTGGGTGGG - Intronic
1158240853 18:55376499-55376521 TATGAAAAGAAGAATTGGGTTGG - Intronic
1158500196 18:57993980-57994002 TAGGAGCAGAAGATTTGTGTGGG - Intergenic
1158826073 18:61221212-61221234 TAGGACAAGCAGATATTGATTGG - Intergenic
1159944016 18:74430196-74430218 CAGGAGAAGCAGAGAAGGGTGGG + Intergenic
1160372797 18:78388952-78388974 GGGGAGAAATAGATTTGGGTAGG - Intergenic
1160611204 18:80086793-80086815 TAGGAGAAGCAGGATGGGGAGGG - Intronic
1160617985 18:80148310-80148332 TGGGAGAGGCAGATTAGGCTGGG + Intronic
1161967493 19:7556552-7556574 CAGGATAAGCAGATTGAGGTAGG + Exonic
1162600420 19:11664418-11664440 TAGGAGGACCTGATTTGGATGGG + Intergenic
1163315036 19:16535773-16535795 TAGGAGGAGCTGGTTTGCGTGGG - Intronic
1164144799 19:22505367-22505389 TAGGAGGAGCAGTCGTGGGTGGG - Intronic
1165022179 19:32934249-32934271 GAGGAGAGGCAGGCTTGGGTTGG + Intronic
1166395333 19:42435534-42435556 TAAGAAAAGGAGATTTGGGCTGG + Intronic
1166629391 19:44391738-44391760 TATGAGATACAGATTTGGTTTGG - Intronic
1168259894 19:55187439-55187461 TAGGAGAAGGGGACTGGGGTGGG + Intronic
926123593 2:10257817-10257839 TCGGAGAAGCAGCTTTGGCTGGG - Intergenic
926218093 2:10917651-10917673 TATGAGAATCAGAATGGGGTGGG - Intergenic
926685933 2:15697532-15697554 TTGGAGACTCAGACTTGGGTGGG - Intronic
927314667 2:21667886-21667908 TGGGAGCAGCAGGTTTGGTTGGG - Intergenic
927372623 2:22374373-22374395 TAGAAGATGCAGATTTGGGCAGG - Intergenic
927877578 2:26669151-26669173 TATGAAAAGCAGATTTGATTTGG - Intergenic
928819519 2:35343291-35343313 TATCAGAAACAGATTTGGGAGGG - Intergenic
928973181 2:37053750-37053772 TGGGAGAAGGAGATCTGGTTTGG - Intronic
929869499 2:45746347-45746369 CAGGAGGAGCAGATTTGGGAAGG - Intronic
930171181 2:48253170-48253192 TAGGACACGCAGATTTGGGGTGG + Intergenic
930266032 2:49200134-49200156 AAGGAGGAGCAAATTGGGGTAGG - Intergenic
931295753 2:60923534-60923556 AAGGAGAAGCAAGTTTGGGAGGG - Exonic
931796112 2:65711720-65711742 TTGGAGAAGCTGATTGGGTTGGG + Intergenic
932376285 2:71238808-71238830 TAGGAGAAGCATATGTGCTTTGG + Intergenic
932576981 2:72968024-72968046 TAGGAAGACTAGATTTGGGTAGG - Intronic
933039953 2:77452008-77452030 TTGGAGAACCAGATGTAGGTTGG + Intronic
933126646 2:78617007-78617029 AAGGATAAGCAGATTTGGAGAGG - Intergenic
934164134 2:89278977-89278999 CAGGAGGATCAGATTTGGGGAGG - Intergenic
934203140 2:89903547-89903569 CAGGAGGATCAGATTTGGGGAGG + Intergenic
934692873 2:96375266-96375288 TAGGAGAAGCAGGGTTGTGGGGG - Intergenic
934772750 2:96917948-96917970 AAGGACAAACAGATTTGAGTTGG + Intronic
935189281 2:100763021-100763043 GAGCAGAAACAGATTTGGGGAGG - Intergenic
936672973 2:114681064-114681086 TAGTTGGAGCAGAATTGGGTAGG - Intronic
937004591 2:118499920-118499942 TAGTAGAAGCACAGTTGAGTGGG + Intergenic
937422650 2:121771395-121771417 TAGGAGAAGGTCATTTTGGTTGG + Intergenic
938588184 2:132712272-132712294 TTGAAGAATCAGGTTTGGGTGGG - Intronic
938700304 2:133872118-133872140 TCTGAGAAGCAGTTTTGGGAGGG + Intergenic
938801986 2:134772154-134772176 CAAAAGAAGCAGATTTGGGAGGG + Intergenic
940663091 2:156572154-156572176 TAGGAGTAGTAGTTTTGGGAAGG - Intronic
940994141 2:160128821-160128843 GAGGAGAAGCAGCTTTGGGTGGG + Intronic
942007718 2:171723226-171723248 GAGGAGAATAAGATGTGGGTAGG + Intronic
942401457 2:175608116-175608138 TAGGATAAGAAGAGTTGGGCTGG + Intergenic
942549313 2:177098013-177098035 TGGAAGAAGCAGATTTGTCTTGG + Intergenic
942564784 2:177255476-177255498 CAGGAGAAGAACATGTGGGTTGG + Intronic
943330415 2:186552099-186552121 TAGGGGAAGCAGGATAGGGTGGG + Intergenic
943451020 2:188042538-188042560 TAGGAAAAGCAGAGTTCTGTGGG - Intergenic
946855829 2:223948833-223948855 TAGGAGGAGCAGGTTTGGAAGGG + Intergenic
946974960 2:225138541-225138563 AAGAGGAAGCAGAATTGGGTAGG + Intergenic
1168856521 20:1013020-1013042 GAAGAGAAGCAGAGGTGGGTGGG + Intergenic
1169445650 20:5669129-5669151 CAGGAGGAGCAGGTTTGGGGAGG + Intergenic
1170406340 20:16041976-16041998 TAGGAGAACCAGAATTGGTTAGG + Intronic
1171234608 20:23514055-23514077 GAGGAGAAGCAGATTTGGGCAGG - Intergenic
1172470829 20:35193675-35193697 TAGAAGAAGCAGGTTTTGGTGGG + Intergenic
1172518040 20:35549267-35549289 TGGGAGAAGCAGAGCTAGGTTGG + Intronic
1173513863 20:43651112-43651134 TAAGAGAAGAGCATTTGGGTTGG - Intergenic
1173944130 20:46936722-46936744 TAGGAGAAACAGATCAGGGGAGG - Intronic
1174055942 20:47798590-47798612 CAGGAGGAGCAGGTTTGGGAAGG - Intergenic
1176455861 21:6909625-6909647 GAGCAGAAGCAAATTTGGGGAGG + Intergenic
1176834034 21:13774673-13774695 GAGCAGAAGCAAATTTGGGGAGG + Intergenic
1178781557 21:35607841-35607863 TAAGAAAAGCAGATATGGGAAGG - Intronic
1180901244 22:19374888-19374910 GAGGAGAGGCAGATGTGGGCTGG - Intronic
1181262113 22:21605962-21605984 CAAGAGAAGCAGATTTGGCTGGG - Intronic
1183322442 22:37173229-37173251 AGGGAGAAGCAAATTTGGGAGGG - Intronic
1184144826 22:42603612-42603634 TGGGAGAAGCAGGTTTGGAGAGG + Intronic
949441824 3:4089752-4089774 TAGGAAAATGAAATTTGGGTTGG - Intronic
950334421 3:12182209-12182231 GAGGAGAAGCAGCTTTATGTGGG + Intronic
951488434 3:23241080-23241102 TGGGTGAAGCAGATTTGGGAGGG - Intronic
953231024 3:41065239-41065261 TTGGTGAAGGAGATCTGGGTAGG - Intergenic
954442258 3:50528198-50528220 TATGAGCAGTAGATTGGGGTAGG - Intergenic
955267223 3:57456775-57456797 GAGGAGAAGCAGATTTGTGGAGG - Intronic
957839813 3:85653539-85653561 TAGGAGAAGCATATTTGTCAGGG + Intronic
959450685 3:106496065-106496087 AAGGGGAAGGAGATCTGGGTAGG - Intergenic
960104073 3:113775097-113775119 TAAGGGAAGTAGATTTAGGTTGG + Intronic
960574793 3:119218875-119218897 CAGGAGAAGCAGGAGTGGGTGGG - Intronic
961698025 3:128719860-128719882 TAGGAGATGCACTTCTGGGTTGG - Intergenic
964541803 3:157787808-157787830 CAGGAGGAGCAGGTTTGGGTTGG - Intergenic
964719013 3:159753377-159753399 TAGGAGGAGAAGGTTTTGGTAGG - Intronic
967206041 3:187122782-187122804 TAGCAGAACCTGATTTGTGTGGG - Intronic
967217141 3:187220304-187220326 TGGGAGAAGGAGACTTGGGCTGG - Intronic
967267124 3:187700624-187700646 TAGGTGAAGCAATTCTGGGTTGG - Intronic
967409294 3:189151306-189151328 TAGAAAAAGCTGATGTGGGTTGG + Intronic
967864518 3:194179378-194179400 TGGGGGAAGCAGCTCTGGGTGGG + Intergenic
968324526 3:197801327-197801349 TAGGAAAGGGAGCTTTGGGTTGG + Intronic
969619623 4:8272622-8272644 TGGGTGAGACAGATTTGGGTCGG - Intronic
970104178 4:12561578-12561600 TAGAAGTAGAAGTTTTGGGTAGG - Intergenic
971082336 4:23227780-23227802 AAGGAAAACCAGGTTTGGGTAGG + Intergenic
971388013 4:26159372-26159394 GAGGAGAAGCTGAGTTGGGGTGG + Intergenic
971829220 4:31668918-31668940 TAGGAAAATCTGATTTGGCTTGG - Intergenic
972234086 4:37109871-37109893 TAGGATAAGCAGATTTGATAGGG - Intergenic
973024969 4:45256769-45256791 TAGAAGTAGCAGATTTGGAATGG - Intergenic
975782765 4:77857301-77857323 TACCAGAAGCAGATGTGGGTGGG + Intergenic
976710505 4:88065892-88065914 TAGGAGAACCGGATTTGATTTGG + Intronic
976714257 4:88106603-88106625 TAGGAGAGGCAGATATGAGATGG + Intronic
977915357 4:102586339-102586361 GAGCAAAAGTAGATTTGGGTGGG + Intronic
979703974 4:123698682-123698704 TTGCAGTAACAGATTTGGGTTGG + Intergenic
979786961 4:124727668-124727690 GAGGAGGAACAGATTTGTGTGGG - Intergenic
980918302 4:139055381-139055403 TAAGAGAAACAGATTTTGGAGGG + Intronic
983621510 4:169766158-169766180 CAGAAGAAACAGATTTGGGAAGG + Intergenic
983790177 4:171786964-171786986 CAGCAGAAGCAGATTTGTGGAGG - Intergenic
984104501 4:175528176-175528198 GAGGAGGAGCTGATTTGGTTAGG - Intergenic
984289896 4:177781909-177781931 TAAGAGAAGCAGATTGGTGGAGG - Intronic
986279206 5:6309679-6309701 GATGAGGAGCAGATGTGGGTAGG - Intergenic
986815737 5:11407994-11408016 CAGGAGAAGGAGATTGGGGGAGG + Intronic
986982453 5:13464819-13464841 TAGGAGAAACAGATTGATGTAGG + Intergenic
992022114 5:72634984-72635006 GAGGAGATGAAGATTGGGGTAGG - Intergenic
992548711 5:77841492-77841514 TATGAGAAGTATATTTGGTTGGG + Intronic
994059271 5:95456095-95456117 TGTGGGAAGCAAATTTGGGTGGG + Intergenic
994080307 5:95701334-95701356 TTGGAGAAGCAGATTCCTGTGGG - Intergenic
994498289 5:100541102-100541124 TATCAGAAACAGATTTGTGTGGG - Intronic
994694823 5:103061082-103061104 TGGGAGAAGCAGGTTTGAGGAGG - Intergenic
996063920 5:119061065-119061087 TAGGATAAGCCATTTTGGGTAGG - Intronic
996246274 5:121267370-121267392 AAGTAGAAGCAGATTTGGGAGGG - Intergenic
996873818 5:128219545-128219567 GAGAAGGACCAGATTTGGGTGGG - Intergenic
997449804 5:133973076-133973098 TTCCAGAAGTAGATTTGGGTAGG - Intronic
997523342 5:134537210-134537232 TAGGAGTAGCAGCCATGGGTGGG - Intronic
999091247 5:148938097-148938119 TAGCAGAAGCAGTTTTGTTTGGG - Intronic
1000223856 5:159239191-159239213 TAGGAGAAAAAGGTTTGGGGAGG - Intergenic
1000911192 5:167024548-167024570 TTGGGGAATCAGATTTGGGTTGG + Intergenic
1000987358 5:167875426-167875448 TAGGAGAGGCAGCTATGGGCTGG + Intronic
1001074540 5:168615656-168615678 TAGGAGAAACAGAGTAGGGGTGG + Intergenic
1001445295 5:171778062-171778084 TAAGACAAGGAGATTTGGCTGGG + Intergenic
1003109350 6:3240636-3240658 CAGAGGAAGCAAATTTGGGTGGG - Intronic
1005347687 6:24906573-24906595 TAGGAGGAGCACAATTGAGTTGG - Intronic
1006583390 6:35089452-35089474 TAGGAAAAGCAGCTTTGTTTGGG + Exonic
1006924240 6:37645762-37645784 AAGGAGAAGCAGGGTTGGGCTGG - Intronic
1007204604 6:40138543-40138565 TAGCACAAGCAGGTTAGGGTGGG - Intergenic
1007212762 6:40208921-40208943 AAGGAGAAGCAGATTTAGATGGG - Intergenic
1008395721 6:51004438-51004460 CGGGAGAAGTAGGTTTGGGTGGG - Intergenic
1008603807 6:53120934-53120956 AAGTGGAAGAAGATTTGGGTAGG - Intergenic
1010061400 6:71626645-71626667 GAGGAGAAGCAAATTTGGAAAGG - Intergenic
1010185678 6:73140938-73140960 TAGGAGAAGCAGATCTTAGGGGG - Intronic
1011310337 6:85973911-85973933 TAGGAGAAGGAGCTGTGGGGAGG + Intergenic
1011417372 6:87136925-87136947 TAGGAGAAGCGGGGTTGGGTGGG - Intergenic
1012152163 6:95768310-95768332 TATGGAAAGCAGATTAGGGTTGG - Intergenic
1012437176 6:99226763-99226785 GAGGGGAAGCAGGTGTGGGTGGG - Intergenic
1013088255 6:106875168-106875190 GAGGAAAAGGAGATTTGGGAGGG - Intergenic
1013254172 6:108367613-108367635 CAGAAAAAGCAGATTTGGTTAGG + Intronic
1013471629 6:110471724-110471746 TAAGAGGAGATGATTTGGGTGGG + Intronic
1013862457 6:114652218-114652240 AGGGAGAAGCAGAATTGGGCAGG - Intergenic
1014244996 6:119058497-119058519 TAAGAGAAGGAGAATTGGGCTGG - Intronic
1016779582 6:147943415-147943437 TTCAAGAAGCAGATTGGGGTGGG - Intergenic
1017592041 6:155988570-155988592 TTGTAGAAGCAGATGTGGATGGG - Intergenic
1017766220 6:157609385-157609407 AAGGAGAAGCTGCTTTGTGTAGG + Intronic
1021003894 7:15369479-15369501 TAGGTGAAACAGACTTGAGTGGG - Intronic
1021555964 7:21918316-21918338 TAGAAGAAGGGGAGTTGGGTCGG - Intronic
1023150131 7:37194304-37194326 TAGGAGATGCAGCTTTGGGAAGG - Intronic
1024842519 7:53603451-53603473 TAGGAGGAGCAGAGGTGGATGGG - Intergenic
1025237050 7:57241577-57241599 CAGGAGGAGCAGGTTTGGGAAGG + Intergenic
1026355296 7:69552141-69552163 CAGGAAAAGCAGATGAGGGTTGG - Intergenic
1027216523 7:76187293-76187315 CAGGAGAAGCACTTTGGGGTAGG - Intergenic
1028129528 7:87153032-87153054 TAGGAGAGGTAGGCTTGGGTGGG + Intronic
1029547954 7:101221133-101221155 CAGGAGAAGCAGACTTGGATGGG + Intronic
1030105244 7:105981785-105981807 TAGGAGAAGCAGATTTGGGTGGG - Intronic
1031597942 7:123669391-123669413 CAGCAGAAGCAGGTTTGGGAGGG + Intergenic
1032390619 7:131553172-131553194 GGGGAGATGCAGATTAGGGTCGG - Intronic
1032458112 7:132088629-132088651 TGGAAGAAGGAGATTTGGGTGGG + Intergenic
1033506720 7:142010350-142010372 AAGGAAAAGCAGATTTGGTGAGG - Intronic
1038228645 8:25680302-25680324 TGGGAGTAGGAGCTTTGGGTTGG + Intergenic
1038666052 8:29539129-29539151 CAGGATAAGTGGATTTGGGTTGG + Intergenic
1038716898 8:29999181-29999203 AATGAGAAGGATATTTGGGTTGG + Intergenic
1038885619 8:31659533-31659555 CAGGAGCAACAGATTGGGGTAGG + Intronic
1038897772 8:31805325-31805347 TAGGAGAAACATTTTAGGGTAGG + Intronic
1039100507 8:33936797-33936819 TAGGTGAAGCAGAATTTGGTGGG + Intergenic
1039357882 8:36841287-36841309 TAAGAGAAACAGATTTGAGAAGG - Intronic
1040005148 8:42614112-42614134 TACAAGAATGAGATTTGGGTGGG + Intergenic
1041773191 8:61495224-61495246 GAGGAGAGGCAGTTTTGGGGAGG - Intronic
1042430427 8:68700233-68700255 TTGGAAAAGAAGATTTGGGGAGG + Intronic
1043586833 8:81779629-81779651 GAGGAGGAGCAGATGTAGGTGGG + Intergenic
1043745834 8:83872284-83872306 TAGAAGAAGCAGCTTTAGGACGG - Intergenic
1047508260 8:125496779-125496801 TGGGAGAAGGAGATTGGGGGTGG + Intergenic
1047568838 8:126075454-126075476 TTTGAGATGGAGATTTGGGTGGG - Intergenic
1048114647 8:131508185-131508207 TAGGACAAACAAATTTGGGCAGG - Intergenic
1048276118 8:133067299-133067321 AAGGAGAAGCAGATGGGGGTGGG - Intronic
1048706656 8:137161174-137161196 TGGGTAAAGCAGACTTGGGTGGG - Intergenic
1050334586 9:4578041-4578063 TAAGAGAAGCACATATAGGTGGG + Intronic
1051414592 9:16825645-16825667 TAGGAGAAAAAGATTTTGCTTGG - Intronic
1054791496 9:69260707-69260729 TAAGAGAACCAGCTTTGGGGAGG - Intergenic
1054841121 9:69741305-69741327 GAAGAGAAACAGATTTAGGTAGG - Intronic
1055326230 9:75132806-75132828 TAAGAGCAGCAGCTTTGAGTAGG + Intronic
1058500740 9:105613007-105613029 TAAGAAAAGTAGATTGGGGTGGG + Intronic
1059872729 9:118595993-118596015 TAGGAGAAGGAGGTTTGGGGTGG + Intergenic
1060527196 9:124327306-124327328 GAGGAGAAGGAGATTGGTGTGGG - Intronic
1060954184 9:127626282-127626304 TAGAAGAAACTGATTTTGGTGGG - Intronic
1062514363 9:136925171-136925193 TAGGCAGAGCAGAGTTGGGTGGG + Intronic
1186435771 X:9542239-9542261 TAGGAGAAGCACAGTTGGAAAGG - Intronic
1188156620 X:26749169-26749191 TAGGAGAAGCAAGTAGGGGTGGG - Intergenic
1188184970 X:27102626-27102648 CAGGAGAAGCATATTTGTGTTGG - Intergenic
1188703091 X:33290026-33290048 AAGGAGGAGCACATTTGGGGTGG - Intronic
1190216169 X:48480819-48480841 TGGGAGGAGCAGGTTTGGGGAGG + Intronic
1190913555 X:54793414-54793436 GAGGAGGAGCAGATTTGGGAGGG - Intronic
1190981417 X:55459496-55459518 TTGGAGCAGCAGCTTTGAGTAGG + Intergenic
1190987281 X:55513684-55513706 TTGGAGCAGCAGCTTTGAGTAGG - Intergenic
1193054878 X:77139307-77139329 TAGTAGAAGGAGAACTGGGTTGG + Intergenic
1193213423 X:78835318-78835340 TAGGAGAAGAATCTTGGGGTTGG - Intergenic
1194326429 X:92523812-92523834 AAAGAGAAGCAGCTTTGGATTGG - Intronic
1195737143 X:108023850-108023872 CAGGAGAAACAGCTTAGGGTTGG + Intergenic
1197287019 X:124607608-124607630 TGGGAGAAGCAGATTGGGTAGGG + Intronic
1198465644 X:136902474-136902496 TGGGAGAAGCATATTTAGATTGG + Intergenic