ID: 1030106746

View in Genome Browser
Species Human (GRCh38)
Location 7:105993885-105993907
Sequence CAGATCAAGGAGATCTGGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030106737_1030106746 28 Left 1030106737 7:105993834-105993856 CCTATGGGCTCACCCTCAGCGGG 0: 1
1: 0
2: 0
3: 5
4: 83
Right 1030106746 7:105993885-105993907 CAGATCAAGGAGATCTGGGCAGG No data
1030106740_1030106746 15 Left 1030106740 7:105993847-105993869 CCTCAGCGGGCTGTACACATAAA 0: 1
1: 0
2: 0
3: 3
4: 60
Right 1030106746 7:105993885-105993907 CAGATCAAGGAGATCTGGGCAGG No data
1030106739_1030106746 16 Left 1030106739 7:105993846-105993868 CCCTCAGCGGGCTGTACACATAA 0: 1
1: 0
2: 0
3: 7
4: 59
Right 1030106746 7:105993885-105993907 CAGATCAAGGAGATCTGGGCAGG No data
1030106741_1030106746 -8 Left 1030106741 7:105993870-105993892 CCTGTCTCTTCCTATCAGATCAA 0: 1
1: 0
2: 2
3: 13
4: 211
Right 1030106746 7:105993885-105993907 CAGATCAAGGAGATCTGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030106746 Original CRISPR CAGATCAAGGAGATCTGGGC AGG Intronic
No off target data available for this crispr