ID: 1030107180 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 7:105996955-105996977 |
Sequence | GATCTGAGCCTATTGTAGAT GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 98 | |||
Summary | {0: 1, 1: 0, 2: 0, 3: 5, 4: 92} |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1030107177_1030107180 | -6 | Left | 1030107177 | 7:105996938-105996960 | CCCAGGCACAAAATGAAGATCTG | No data | ||
Right | 1030107180 | 7:105996955-105996977 | GATCTGAGCCTATTGTAGATGGG | 0: 1 1: 0 2: 0 3: 5 4: 92 |
||||
1030107178_1030107180 | -7 | Left | 1030107178 | 7:105996939-105996961 | CCAGGCACAAAATGAAGATCTGA | 0: 1 1: 0 2: 3 3: 18 4: 223 |
||
Right | 1030107180 | 7:105996955-105996977 | GATCTGAGCCTATTGTAGATGGG | 0: 1 1: 0 2: 0 3: 5 4: 92 |
||||
1030107176_1030107180 | 5 | Left | 1030107176 | 7:105996927-105996949 | CCTGGCACTATCCCAGGCACAAA | No data | ||
Right | 1030107180 | 7:105996955-105996977 | GATCTGAGCCTATTGTAGATGGG | 0: 1 1: 0 2: 0 3: 5 4: 92 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1030107180 | Original CRISPR | GATCTGAGCCTATTGTAGAT GGG | Intronic | ||