ID: 1030107180

View in Genome Browser
Species Human (GRCh38)
Location 7:105996955-105996977
Sequence GATCTGAGCCTATTGTAGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 98
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 92}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030107176_1030107180 5 Left 1030107176 7:105996927-105996949 CCTGGCACTATCCCAGGCACAAA 0: 1
1: 0
2: 3
3: 62
4: 521
Right 1030107180 7:105996955-105996977 GATCTGAGCCTATTGTAGATGGG 0: 1
1: 0
2: 0
3: 5
4: 92
1030107177_1030107180 -6 Left 1030107177 7:105996938-105996960 CCCAGGCACAAAATGAAGATCTG 0: 1
1: 0
2: 1
3: 25
4: 222
Right 1030107180 7:105996955-105996977 GATCTGAGCCTATTGTAGATGGG 0: 1
1: 0
2: 0
3: 5
4: 92
1030107178_1030107180 -7 Left 1030107178 7:105996939-105996961 CCAGGCACAAAATGAAGATCTGA 0: 1
1: 0
2: 3
3: 18
4: 223
Right 1030107180 7:105996955-105996977 GATCTGAGCCTATTGTAGATGGG 0: 1
1: 0
2: 0
3: 5
4: 92

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030107180 Original CRISPR GATCTGAGCCTATTGTAGAT GGG Intronic
905018895 1:34795048-34795070 GATGAGAGCCCATTGTAGGTGGG - Exonic
909527732 1:76645323-76645345 GATCTGAGCCTATAATAGGAGGG + Intergenic
916341457 1:163740646-163740668 TATTTGTGGCTATTGTAGATGGG + Intergenic
920745334 1:208622236-208622258 CATGTGTGACTATTGTAGATGGG - Intergenic
921942564 1:220857564-220857586 TATATGTGCCTATTGTAAATGGG + Intergenic
921994399 1:221402004-221402026 TATGTGTGCCTATTGTAAATGGG - Intergenic
1066270033 10:33813377-33813399 GATCTGATGGTTTTGTAGATGGG - Intergenic
1066679413 10:37922651-37922673 TATCTGTGGCTATTGTAAATGGG - Intergenic
1068141173 10:53009214-53009236 GATCTGATCTTTATGTAGATAGG + Intergenic
1070058908 10:72962541-72962563 TATCTGGGGCTATTGTAAATGGG + Intergenic
1076062356 10:127423312-127423334 GAGCTGAGCTTATTATATATCGG - Intronic
1082203448 11:49402640-49402662 GATTAGAGTCAATTGTAGATGGG - Intergenic
1086792497 11:91060163-91060185 GATATTAGACTTTTGTAGATGGG - Intergenic
1087728091 11:101745793-101745815 GATCTGATCCTAGTGAAGACAGG + Intronic
1089235613 11:117022130-117022152 GATCTGATCATTTTGTAGTTGGG + Intronic
1096559746 12:52427231-52427253 GGGCTGAGCTTATTGTATATAGG + Intronic
1097714310 12:62949758-62949780 TATCTGTGGCTATTGTAAATGGG + Intergenic
1098142581 12:67465592-67465614 GATATGTGGCTATTGTAAATGGG + Intergenic
1100652541 12:96606149-96606171 GAGCTGAGCCTATTTTAGACGGG + Intronic
1107265903 13:38554042-38554064 GTTCTGAGCCACTTATAGATGGG + Intergenic
1111478525 13:88787814-88787836 GTTCTGAGCATATTTAAGATGGG + Intergenic
1115926546 14:38442120-38442142 AATCTGAACCTATTTTAGGTGGG - Intergenic
1116209333 14:41912979-41913001 GATCAGAGTCTATTAAAGATAGG - Intergenic
1118012768 14:61626785-61626807 GATCAGAGTCTAATGGAGATTGG - Intronic
1118384304 14:65243069-65243091 GAGCTGAGCCTGATGTAAATAGG + Intergenic
1118517951 14:66547172-66547194 AATCTTAGCTTTTTGTAGATGGG + Intronic
1119984053 14:79115666-79115688 GATCTCAGCCTAGTATTGATTGG + Intronic
1122837210 14:104436171-104436193 GAGCTGAGCCTCCTGCAGATGGG + Intergenic
1123111968 14:105876199-105876221 GTTCTGAGCCTCCTGGAGATGGG + Intergenic
1126098451 15:45105613-45105635 GACCTGTGCCTTTTGGAGATGGG - Intronic
1129369631 15:75082375-75082397 TATCTGAGCCATTTGCAGATCGG - Intronic
1137039443 16:35597034-35597056 GATCTGAGGCTACTGAAGAAGGG + Intergenic
1138628255 16:58270273-58270295 GTTCTGAGCATATTTAAGATAGG - Intronic
1139472737 16:67186922-67186944 GATCTGACCCTGCTGGAGATGGG + Intronic
1139564757 16:67767199-67767221 GATCTGAGTCTCTTTGAGATGGG - Intronic
1140170552 16:72599758-72599780 GACCTGAGGCCATTGTAGAAGGG - Intergenic
1154387383 18:13906772-13906794 TATTTGAGGCTATTGTAAATGGG - Intronic
1158392580 18:57055621-57055643 GATCTGAGCCCATTACAGAGTGG + Intergenic
935790867 2:106588901-106588923 TATCAGAGCCAATTGTTGATTGG - Intergenic
940314572 2:152314371-152314393 TATCTGTGGCTATTGTAAATGGG + Intergenic
943071641 2:183147929-183147951 GATATGTGGCTATTGTAAATGGG + Intronic
944095621 2:195964392-195964414 TATTTGAGACTATTGTAAATGGG + Intronic
948950862 2:241250453-241250475 AATCTGAGCCAACAGTAGATGGG - Intronic
1173177451 20:40775111-40775133 GCTCTCAGCCCATTGCAGATGGG + Intergenic
1174764530 20:53240222-53240244 GATCTAAGCCAATTGGTGATTGG - Intronic
1175651138 20:60724416-60724438 GATGTGAGCCCATTGTAGTGTGG + Intergenic
1179349630 21:40595694-40595716 GATCTGATCCTCTTATAAATTGG - Intronic
951600660 3:24371160-24371182 GATGTCTGCCTAATGTAGATAGG - Intronic
951607328 3:24450716-24450738 AAGCTGAGCCTACTATAGATTGG - Intronic
953728560 3:45424290-45424312 GTTCTGAGCCTATTTAAGGTAGG - Intronic
960984589 3:123267502-123267524 TATCTGAGCCAATTATAAATAGG - Intronic
962584131 3:136824472-136824494 GATTTGTGGCTATTGTAAATGGG + Intronic
962622361 3:137192421-137192443 GAGATGAGTCTATTGTAGGTAGG + Intergenic
962689063 3:137875094-137875116 TATCTGTGGCTATTGTAAATGGG - Intergenic
963002353 3:140694271-140694293 GACCTGAGCCTAGTGGAGTTGGG - Intronic
963759181 3:149269099-149269121 GATCTGAGAATAAGGTAGATAGG + Intergenic
964756608 3:160095044-160095066 GACCTGAGGCTAATGTAGGTGGG - Intergenic
965010070 3:163076494-163076516 TATCTGAGGCTATTGTAAATGGG - Intergenic
974513486 4:62876355-62876377 TATCTGTGGCTATTGTAAATGGG - Intergenic
975926323 4:79458714-79458736 GATCTGAGCACATTGAAGGTAGG + Intergenic
977522106 4:98097861-98097883 TATCTGTGGCTATTGTAAATGGG - Intronic
977846017 4:101768086-101768108 TATTTGTGCCTATTGTAAATGGG + Intronic
977983140 4:103349743-103349765 GATCTGGGCCTATTTTGGCTGGG + Intergenic
978519637 4:109602941-109602963 TATCTGTGGCTATTGTAAATGGG + Intronic
978564006 4:110062797-110062819 GATTGGAGCCTATTGTACAAAGG - Intronic
986605648 5:9520543-9520565 CATCTGGGCCTATTGAAGATAGG + Intronic
993193357 5:84706420-84706442 CATGTGTGCCTATTGTAAATGGG - Intergenic
993566460 5:89482052-89482074 GATTTGCTCCTTTTGTAGATAGG + Intergenic
994596844 5:101849199-101849221 TATATGTGGCTATTGTAGATGGG + Intergenic
996604941 5:125310691-125310713 GCTCTGAGCCTACTGAAGTTAGG - Intergenic
998187557 5:139993534-139993556 GATGTGAGACTATTTTAGATTGG - Intronic
1003682518 6:8269944-8269966 GAACTGAGACTATTGAAGAGTGG + Intergenic
1004897716 6:20164974-20164996 GTTCTGAGCATATTTAAGATAGG + Intronic
1008731471 6:54487794-54487816 GCTTTGTGCCTATTGTAAATTGG + Intergenic
1010661840 6:78580601-78580623 GATTTGAGACTACTGTACATTGG + Intergenic
1011851816 6:91638717-91638739 GATCAGAGCCTATTTTAGCCAGG - Intergenic
1012817448 6:104041888-104041910 TTTCTGTGGCTATTGTAGATGGG - Intergenic
1012888353 6:104871236-104871258 TATGTGAGCATACTGTAGATGGG + Intergenic
1013277018 6:108595020-108595042 AATCTGAGCCTAGTGTTGTTTGG - Intronic
1016331176 6:142953276-142953298 GATCTGACCCTCTTTTATATAGG + Intergenic
1016347867 6:143134882-143134904 GTTCTGAGCACATTTTAGATAGG + Intronic
1018361332 6:163072848-163072870 TATCTGTGGCTATTGTAAATGGG - Intronic
1021528484 7:21616774-21616796 GAACTGAGCCTATTGTAATTTGG + Intronic
1029042291 7:97589311-97589333 TATCTGTGGCTATTGTAAATTGG + Intergenic
1029531773 7:101130221-101130243 GATCTGAGACTTTTGAAGAAAGG + Intronic
1030107180 7:105996955-105996977 GATCTGAGCCTATTGTAGATGGG + Intronic
1034019226 7:147623497-147623519 TATCTGTGGCTATTGTAAATGGG - Intronic
1044379170 8:91513149-91513171 GTTCTGAGCCTACTGATGATAGG - Intergenic
1053515250 9:38725014-38725036 GCTCTGAGCCTATTCTGGTTCGG + Intergenic
1058748154 9:108012272-108012294 GCTCTGAGACTATTCCAGATTGG - Intergenic
1186508827 X:10115576-10115598 GAATCGAGCCTATTGTGGATAGG - Intronic
1186570623 X:10711507-10711529 GAACTGTTCCTATTGTATATGGG - Intronic
1188020342 X:25150287-25150309 TATATGTGGCTATTGTAGATGGG + Intergenic
1190893461 X:54592061-54592083 TATTTGTGGCTATTGTAGATGGG + Intergenic
1191793118 X:64992304-64992326 AATCTGAGCCTGTCGGAGATTGG - Intronic
1194789591 X:98130422-98130444 GATATTAGTCTATTGTAAATGGG - Intergenic
1197567836 X:128110552-128110574 TATTTGAGGCTATTGTAAATGGG + Intergenic
1197810650 X:130439586-130439608 TATTTGTGGCTATTGTAGATGGG + Intergenic