ID: 1030110342

View in Genome Browser
Species Human (GRCh38)
Location 7:106021508-106021530
Sequence GGTAATGAGTCTGGAGCCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 3, 3: 13, 4: 173}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030110338_1030110342 3 Left 1030110338 7:106021482-106021504 CCTGCTCCATTTACTGGTGTTCA 0: 1
1: 0
2: 0
3: 13
4: 136
Right 1030110342 7:106021508-106021530 GGTAATGAGTCTGGAGCCAGTGG 0: 1
1: 0
2: 3
3: 13
4: 173
1030110340_1030110342 -3 Left 1030110340 7:106021488-106021510 CCATTTACTGGTGTTCAGTCGGT 0: 1
1: 0
2: 0
3: 3
4: 73
Right 1030110342 7:106021508-106021530 GGTAATGAGTCTGGAGCCAGTGG 0: 1
1: 0
2: 3
3: 13
4: 173

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030110342 Original CRISPR GGTAATGAGTCTGGAGCCAG TGG Intronic
900356712 1:2268447-2268469 GGTAGTGAGTCAGGTGCCCGGGG + Intronic
902389419 1:16094444-16094466 GTTGATGCCTCTGGAGCCAGGGG + Intergenic
903259646 1:22124422-22124444 GGCATTGAGGCTGGACCCAGAGG - Intronic
904310433 1:29625941-29625963 GGTACTGACTCTGGAGCCAGAGG + Intergenic
904692492 1:32304250-32304272 TGTCATGTCTCTGGAGCCAGTGG + Intronic
905912461 1:41663488-41663510 GGGCATGACTTTGGAGCCAGAGG - Intronic
908992785 1:70113466-70113488 GGCAATGAGTCTGGAGCCAAAGG - Intronic
911083622 1:93957853-93957875 GGGCATGAGTCAGGAGTCAGAGG - Intergenic
914001277 1:143696800-143696822 GGTAAGGAGTTTGAAACCAGCGG - Intergenic
914319503 1:146545436-146545458 GGTTATGAGTTTGGAGCCCAAGG + Intergenic
915748024 1:158180296-158180318 GTGAATGAGTCAGGAGCCAGAGG + Intronic
917740662 1:177959109-177959131 GGTAATGAGTCTATAGCTATAGG + Intronic
919779258 1:201212016-201212038 GGACATGAGGCTGGACCCAGAGG + Exonic
920052273 1:203171368-203171390 GGTGATTGGTATGGAGCCAGGGG - Exonic
922072880 1:222213768-222213790 TGTAATTAGTTTGGAGACAGAGG - Intergenic
922133242 1:222799567-222799589 GGACATGACTCTGGAACCAGAGG - Intergenic
922795015 1:228335548-228335570 GGAAATGTCTCTGGAGCCAGCGG - Intronic
923465197 1:234242069-234242091 GCTAATGAAACAGGAGCCAGTGG + Intronic
923658767 1:235940760-235940782 GGTCATCAGTCTGGAGCCAAGGG - Intergenic
923713546 1:236406053-236406075 GGTTTGGAGTGTGGAGCCAGGGG - Intronic
924553808 1:245102200-245102222 GAGAATGCGTCTGGAGCCTGAGG + Intronic
1064000663 10:11661502-11661524 GGTAATGAGTGGGGAGTGAGGGG - Intergenic
1064969970 10:21055375-21055397 GGAAATAGGTCTGGAGGCAGAGG + Intronic
1069354583 10:67569523-67569545 GGTAAAGAGTCTGAAATCAGAGG + Intronic
1072801611 10:98396096-98396118 TGCAAAGAGTATGGAGCCAGTGG - Intronic
1076783932 10:132739697-132739719 GGAAAGGAGTCTGGAGCCTCCGG + Intronic
1078420729 11:11210042-11210064 GGTAATGAGGCTGGACGCAGGGG - Intergenic
1078558413 11:12350166-12350188 GGTAATGGGTCTGGAGCTGAAGG + Intronic
1081017254 11:37897709-37897731 GGGAATGAGTGTGAAGACAGAGG - Intergenic
1081495142 11:43601665-43601687 GGACATGAATCTGAAGCCAGAGG - Intronic
1081646052 11:44791478-44791500 GGCAATGATTCCGGAGCGAGTGG + Intronic
1081664557 11:44909258-44909280 GGTGTTGAGGCTGGAGTCAGGGG + Intronic
1083644527 11:64164917-64164939 GGGCATGAGTCTGGGGCCTGGGG - Intronic
1083737217 11:64688270-64688292 GGTAAAGGGACTGGAGCCCGTGG - Intronic
1084504082 11:69554264-69554286 GGAAAGGAGTCAGGGGCCAGTGG - Intergenic
1084954553 11:72684440-72684462 GGTAATGAGGCTCTAGGCAGAGG + Intergenic
1084971356 11:72774017-72774039 GGTGATGAGTCTTGAGGTAGAGG - Intronic
1086885699 11:92202783-92202805 TGTAATGTGAATGGAGCCAGAGG - Intergenic
1089360480 11:117882841-117882863 TGTTCTGAGCCTGGAGCCAGTGG - Intergenic
1089461600 11:118657340-118657362 GGTGATGAGTCTGCAACTAGGGG - Exonic
1089489212 11:118871388-118871410 GGGAGTGAGGTTGGAGCCAGTGG - Intergenic
1089558808 11:119332986-119333008 GGTAATGATTCTGAGGCCAAGGG + Intergenic
1090580688 11:128155282-128155304 GGTAACATTTCTGGAGCCAGTGG - Intergenic
1092674959 12:10905902-10905924 AGGACTGAGTCTGGAGTCAGAGG - Intronic
1093899860 12:24619373-24619395 GAAAGTGAGTCTGGAGCCTGGGG + Intergenic
1096654057 12:53077572-53077594 GATAAAGAATCTGGAGGCAGTGG + Intronic
1098600881 12:72330507-72330529 GGTCATGCTTCTGCAGCCAGGGG + Intronic
1102200708 12:111055790-111055812 GGTAAGTAGGCTTGAGCCAGAGG + Intronic
1102606996 12:114075501-114075523 GGCAAAGTGTCGGGAGCCAGTGG + Intergenic
1103746568 12:123128846-123128868 ATTAATGAGGCTGGGGCCAGTGG + Intronic
1108545932 13:51493492-51493514 GGTGGTGAGTCTGGAGCCAGTGG + Intergenic
1118480060 14:66155525-66155547 GGAGATGAGACTGGAGCCAGTGG - Intergenic
1119216283 14:72871644-72871666 GGTAATGAGGCTGGGCACAGTGG + Intronic
1119282955 14:73426308-73426330 GGTAAGGCCTCTGAAGCCAGAGG + Intronic
1121059687 14:90895217-90895239 GGTAATGAGGCTGGGCTCAGTGG + Intronic
1122686578 14:103510940-103510962 GGTCCTGAGGGTGGAGCCAGGGG + Intergenic
1124001400 15:25763399-25763421 GGAAGTGAGTCTGGATGCAGGGG - Intronic
1126914558 15:53451465-53451487 GGCAATGAGTCTGGGGCCAATGG - Intergenic
1129326551 15:74802967-74802989 GGGAATGAGGCTGGGGCGAGGGG - Exonic
1129642313 15:77393232-77393254 GGTGCTGGGTTTGGAGCCAGTGG + Intronic
1131233138 15:90673974-90673996 GGCAGAGAGTCTGGAGACAGTGG + Intergenic
1131372271 15:91892483-91892505 GGAAATTCCTCTGGAGCCAGAGG - Intronic
1131509841 15:93043921-93043943 TGAAATGAGGCGGGAGCCAGCGG + Intronic
1132376518 15:101331830-101331852 GGTAATGAGCCTGAAGTAAGAGG - Exonic
1137952988 16:52801213-52801235 GGTACTGAGTCTGGAGAAATTGG - Intergenic
1138450028 16:57088178-57088200 GGTTAGGAGCCTGGGGCCAGAGG + Intergenic
1140014020 16:71164645-71164667 GGTTATGAGTTTGGAGCCCAAGG - Intronic
1141028049 16:80566277-80566299 GACTATGAATCTGGAGCCAGTGG - Intergenic
1141097590 16:81173948-81173970 GGTACTGAGTGTGGTGCTAGAGG - Intergenic
1144070296 17:11665754-11665776 GGTAAATAGTTTGAAGCCAGAGG + Intronic
1144511610 17:15881891-15881913 TGTACTGACTCTGTAGCCAGCGG + Intergenic
1148029165 17:44608190-44608212 GGGGATGAGTGTGGAGGCAGGGG - Intergenic
1148631286 17:49111346-49111368 GGAAATGAGCCTGAAGCTAGAGG - Intergenic
1149284139 17:55143352-55143374 GTAAATGAGTCTGGATCCTGTGG + Intronic
1150087738 17:62288628-62288650 GGTAATCTTTCTGGAGTCAGTGG - Intergenic
1150119253 17:62585864-62585886 GGAAATGATTCTGAAGGCAGGGG + Intronic
1151832719 17:76564513-76564535 GGTAGTGGGCTTGGAGCCAGAGG - Intronic
1152507326 17:80758723-80758745 GGTGTTGATTCTGGAGTCAGGGG - Intronic
1153201130 18:2648863-2648885 GGGAATGAGTCTGGGCACAGCGG + Intergenic
1153735882 18:8066762-8066784 GGTAATCAGACAGGAGACAGAGG - Intronic
1156010151 18:32487821-32487843 GGTAAGGAATCTGTAGCCTGGGG - Intergenic
1157496831 18:48162206-48162228 GGGAAGGAGGCTGGGGCCAGGGG - Intronic
1159919582 18:74215474-74215496 GGTAATAGGTCTGGAGGCAAAGG + Intergenic
1160182872 18:76650921-76650943 GGAAAGGAGTCTGCAGACAGTGG + Intergenic
1163862397 19:19749151-19749173 GGCAATAAGCCTTGAGCCAGGGG + Intergenic
1164050682 19:21583844-21583866 GGTAATGAGTCTTAAGTCACTGG + Intergenic
1166279382 19:41780844-41780866 GGAAATGAGACAGGAGACAGAGG + Intergenic
1167425920 19:49429499-49429521 GGGAATGGGGCAGGAGCCAGGGG - Exonic
1168018897 19:53594731-53594753 GGTAGACAGTCTGGAGCCATGGG + Intergenic
925073188 2:987520-987542 GGTTAAGTGCCTGGAGCCAGGGG + Intronic
925434388 2:3824597-3824619 AGTAATGAATTTGAAGCCAGTGG - Intronic
926332520 2:11837230-11837252 GGGAATGATTCTGTAGACAGTGG - Intergenic
927020186 2:19008724-19008746 GGCAGGGACTCTGGAGCCAGAGG + Intergenic
928477849 2:31649337-31649359 TCTAATGTGTCAGGAGCCAGTGG - Intergenic
929298472 2:40274102-40274124 GCTGAAGAGTCTGGAGTCAGAGG + Intronic
931185058 2:59941839-59941861 GGTAATATGGCTGGACCCAGAGG - Intergenic
931233168 2:60391284-60391306 GGTAATGATGGTGGAGTCAGGGG - Intergenic
932108690 2:68973054-68973076 GGTAATAAGCCTGGAGTAAGGGG - Intergenic
932582068 2:72998612-72998634 GGTAACGTGGCTGGAGCGAGCGG - Intronic
935595466 2:104874044-104874066 ATTAAGGAGTCTGCAGCCAGAGG + Intergenic
942090042 2:172480969-172480991 GGCCTTGACTCTGGAGCCAGGGG - Intronic
942503221 2:176614213-176614235 GGAAATGATTCTGAAGCCATAGG - Intergenic
943270914 2:185802480-185802502 GATAAAGAGTCTGAAGACAGTGG + Exonic
943502943 2:188714959-188714981 GGTAATGAGGCTGGGCGCAGTGG + Intergenic
944579725 2:201121491-201121513 GGTGATGAGACTGAAGCAAGTGG + Intronic
944683834 2:202100403-202100425 GGTGATTATTCTGGAGCCAGTGG - Exonic
947044787 2:225969418-225969440 AGTAATGAGGCTGGACCCAGGGG + Intergenic
947282451 2:228470374-228470396 GGCAAAGAGTCTGGAGCTATGGG - Intergenic
947805025 2:232960497-232960519 GGTCATGGGTGTGGAGTCAGAGG + Intronic
948379610 2:237543066-237543088 GGTAGTGAGTGGGGAGACAGTGG + Intronic
948379931 2:237544254-237544276 AGTAATGAGTCGGGGGACAGTGG + Intronic
948380104 2:237544896-237544918 AGTAATGAGTCGGGGGACAGTGG + Intronic
1168857163 20:1016778-1016800 GGGAAGGAGGCTGGGGCCAGGGG - Intergenic
1171182144 20:23098546-23098568 GGGGATGAGGCTGGAGCCAGGGG - Intergenic
1173670218 20:44793675-44793697 GGTAATAAGAGTGAAGCCAGAGG + Intronic
1174086576 20:48012938-48012960 GGGAGGGAGTCTGGAGTCAGTGG - Intergenic
1175066218 20:56290893-56290915 GGTGAGGAGTCTGGAGTCAAGGG - Intergenic
1175182808 20:57160498-57160520 GACAATGAGGCTGGAGCCTGAGG - Intergenic
1175746264 20:61459442-61459464 GGTATTGTGTAGGGAGCCAGGGG + Intronic
1176092525 20:63325494-63325516 GGTAGTGTGGCTGGGGCCAGGGG + Exonic
1178536596 21:33414949-33414971 GGTCCTGAGTTGGGAGCCAGTGG + Exonic
1180068746 21:45425609-45425631 GGTCCTGTGTCTGGAGTCAGAGG + Intronic
1182500246 22:30741408-30741430 TGTCATGAGTCTGGAGGAAGTGG + Intronic
1184161098 22:42697799-42697821 AGTAGTGAGCCTGGAGGCAGGGG - Intronic
1184749034 22:46473604-46473626 GGGAATGACTCTGGACCCCGAGG - Intronic
950874416 3:16257046-16257068 GCTCATGAGTCTGGCGCCTGGGG - Intergenic
952102024 3:30025457-30025479 GGTAATGAGGCAGGTGCCAGTGG - Intergenic
953622283 3:44543475-44543497 GGTACTGGGTTAGGAGCCAGAGG + Intergenic
953665352 3:44922276-44922298 GGTGAGTAGTCTAGAGCCAGGGG - Intronic
954073090 3:48157537-48157559 GGTAAGGAGGCTGGCACCAGAGG + Exonic
957491702 3:80935395-80935417 GCAAATTACTCTGGAGCCAGTGG + Intergenic
957929948 3:86864296-86864318 TGTAATGAGCCTGGAGTCTGGGG + Intergenic
958943599 3:100339644-100339666 GGTAAAGAGCCTGTAGCCACAGG - Intronic
963009801 3:140758614-140758636 GGAAATGGGGCTGGTGCCAGGGG + Intergenic
963306184 3:143655832-143655854 CGGAATGAGTGAGGAGCCAGTGG + Intronic
969737783 4:9002483-9002505 GAACAAGAGTCTGGAGCCAGGGG + Intergenic
975493421 4:75012832-75012854 GGTGATGAGGCTGGAGCTTGAGG - Exonic
983946550 4:173592150-173592172 TGTAATTAGTCTAGAGCAAGCGG + Intergenic
984035573 4:174663793-174663815 GGTAATGACTCTGAATCCATGGG - Intronic
986627225 5:9733483-9733505 GTTAATGGGTCTGAAACCAGTGG + Intergenic
991944858 5:71890162-71890184 GGTAATGAGTTTGAACCAAGGGG + Intergenic
999681282 5:154062740-154062762 GGCAATGAGTTTGGACCCATAGG - Intronic
1001566766 5:172704629-172704651 GACTATGAGTCTGGAGCCGGAGG + Intergenic
1005899846 6:30207688-30207710 GGAAATGAGCCTGGAGACACAGG - Intronic
1006009708 6:31032205-31032227 GGCAGTGAGTCTGGTTCCAGTGG - Exonic
1016098343 6:140065789-140065811 TGTAATGAGGCTGGAGATAGTGG + Intergenic
1023828782 7:44027722-44027744 TGTGAGGAGCCTGGAGCCAGTGG + Intergenic
1024259036 7:47560197-47560219 GGTCATGAGGCTGGAGCCTCAGG + Intronic
1026898745 7:74025821-74025843 GGGAGAGAGTCCGGAGCCAGGGG - Intergenic
1027195167 7:76025091-76025113 GGGAATGAGGCTGGAGACAGAGG + Intronic
1029383106 7:100226107-100226129 GGTGCTGAGGCTGGAGGCAGTGG + Intronic
1029739080 7:102481979-102482001 TGTGAGGAGCCTGGAGCCAGTGG + Intergenic
1029757081 7:102581158-102581180 TGTGAGGAGCCTGGAGCCAGTGG + Exonic
1029775022 7:102680219-102680241 TGTGAGGAGCCTGGAGCCAGTGG + Intergenic
1029936802 7:104433538-104433560 GGAAATGAGTCTGGAGAGATGGG - Intronic
1030080813 7:105776198-105776220 AGTGATGAGTCAGAAGCCAGGGG + Intronic
1030110342 7:106021508-106021530 GGTAATGAGTCTGGAGCCAGTGG + Intronic
1030304852 7:108007057-108007079 GGCAATGAGGTTGGAGCAAGGGG - Intergenic
1032317688 7:130855187-130855209 AGAAATGATTCTGGGGCCAGGGG + Intergenic
1036660821 8:10707337-10707359 GGAACTGTGTCTGCAGCCAGGGG + Intronic
1039569970 8:38578956-38578978 GGGAATGAGGCTGGGGACAGGGG - Intergenic
1039967944 8:42297423-42297445 GGCAATGAATCCGGACCCAGCGG - Intronic
1041481954 8:58331904-58331926 GGAAATGGGGCTGGAGCCAGGGG + Intergenic
1042235986 8:66613432-66613454 GGGAAGGAGCCGGGAGCCAGGGG + Intronic
1043178680 8:77055239-77055261 TGTAATGAGTTTGGACCAAGTGG - Intergenic
1044368275 8:91376884-91376906 GGTCATGAGTCCTGAGGCAGGGG - Intronic
1047411760 8:124629925-124629947 GGTGATGAGTCAGCAGCCACTGG - Intronic
1047721788 8:127647328-127647350 GGTAATGAGGTTGGTGTCAGAGG + Intergenic
1049766463 8:144357581-144357603 CGGAAGGAGCCTGGAGCCAGGGG + Intronic
1050839492 9:10129625-10129647 TGGAATGAATTTGGAGCCAGAGG - Intronic
1055310861 9:74978136-74978158 GGTACTGAACCTGGAGACAGTGG + Intergenic
1056548331 9:87631185-87631207 GGTAATTAGTATGTAGACAGGGG + Intronic
1057809742 9:98248559-98248581 GGTTATGAGTCTGCAGCCTAGGG + Intronic
1058288155 9:103205715-103205737 GGTAGTGGGCTTGGAGCCAGAGG - Intergenic
1058905027 9:109475856-109475878 GCCAAGGAGTCTGAAGCCAGTGG + Intronic
1059413550 9:114149334-114149356 GGTAATGTGTCCGGAACCATTGG - Intergenic
1060017407 9:120098670-120098692 GGTAATGTTTCTGAAGCCTGGGG + Intergenic
1060044111 9:120326378-120326400 TGTGATGAGGCTGGAGACAGAGG - Intergenic
1062028610 9:134352015-134352037 GGTCATGGTGCTGGAGCCAGAGG + Intronic
1062068101 9:134539810-134539832 GGTCCTGAGGCTGGGGCCAGGGG + Intergenic
1062310021 9:135930449-135930471 GGTGAGGAGTCTGAAGGCAGGGG - Intergenic
1062690617 9:137840333-137840355 AGAAATGAGGCTGGAGCAAGTGG - Intronic
1190000922 X:46685628-46685650 GGTAATGAGATTGGTGGCAGTGG + Intronic
1190928256 X:54927523-54927545 GGTAGTGAGTCTGGGGCTGGAGG + Intronic
1191112043 X:56811730-56811752 GGAAAGGAGGCTGAAGCCAGGGG - Intergenic
1192311004 X:70013896-70013918 GGTAATGAGTAGGGAGGCAGGGG - Intronic
1192609261 X:72551698-72551720 GGAACTGAGACTGGAGGCAGGGG - Intronic
1196052357 X:111319070-111319092 GGAGATGAGGCTGGAGACAGAGG + Intronic
1197639961 X:128956539-128956561 GGCAATGAGAATGGAGACAGTGG + Intergenic
1199264553 X:145815975-145815997 GGTGATGTGTCTGTAGCCAAAGG - Intergenic