ID: 1030114873

View in Genome Browser
Species Human (GRCh38)
Location 7:106055468-106055490
Sequence GACCCACCTGGAAAACTGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030114873_1030114881 25 Left 1030114873 7:106055468-106055490 CCCATCAGTTTTCCAGGTGGGTC No data
Right 1030114881 7:106055516-106055538 AAGAGGCTCAGGTGAGAGGCTGG No data
1030114873_1030114880 21 Left 1030114873 7:106055468-106055490 CCCATCAGTTTTCCAGGTGGGTC No data
Right 1030114880 7:106055512-106055534 TGAGAAGAGGCTCAGGTGAGAGG No data
1030114873_1030114876 -2 Left 1030114873 7:106055468-106055490 CCCATCAGTTTTCCAGGTGGGTC No data
Right 1030114876 7:106055489-106055511 TCGTTCCAATGTCTGTTTTGCGG No data
1030114873_1030114882 26 Left 1030114873 7:106055468-106055490 CCCATCAGTTTTCCAGGTGGGTC No data
Right 1030114882 7:106055517-106055539 AGAGGCTCAGGTGAGAGGCTGGG No data
1030114873_1030114878 8 Left 1030114873 7:106055468-106055490 CCCATCAGTTTTCCAGGTGGGTC No data
Right 1030114878 7:106055499-106055521 GTCTGTTTTGCGGTGAGAAGAGG No data
1030114873_1030114879 14 Left 1030114873 7:106055468-106055490 CCCATCAGTTTTCCAGGTGGGTC No data
Right 1030114879 7:106055505-106055527 TTTGCGGTGAGAAGAGGCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030114873 Original CRISPR GACCCACCTGGAAAACTGAT GGG (reversed) Intergenic
No off target data available for this crispr