ID: 1030115722

View in Genome Browser
Species Human (GRCh38)
Location 7:106060870-106060892
Sequence TTTTCCATGAACAAGGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030115718_1030115722 4 Left 1030115718 7:106060843-106060865 CCAGGGACCAGTTTCATGGAAGA 0: 275
1: 558
2: 1130
3: 1239
4: 1262
Right 1030115722 7:106060870-106060892 TTTTCCATGAACAAGGAGGATGG No data
1030115714_1030115722 20 Left 1030115714 7:106060827-106060849 CCCAACCTTTCTGGCACCAGGGA 0: 47
1: 1067
2: 1654
3: 1380
4: 991
Right 1030115722 7:106060870-106060892 TTTTCCATGAACAAGGAGGATGG No data
1030115716_1030115722 15 Left 1030115716 7:106060832-106060854 CCTTTCTGGCACCAGGGACCAGT 0: 28
1: 470
2: 875
3: 1290
4: 1141
Right 1030115722 7:106060870-106060892 TTTTCCATGAACAAGGAGGATGG No data
1030115715_1030115722 19 Left 1030115715 7:106060828-106060850 CCAACCTTTCTGGCACCAGGGAC 0: 44
1: 1042
2: 1735
3: 1400
4: 1034
Right 1030115722 7:106060870-106060892 TTTTCCATGAACAAGGAGGATGG No data
1030115719_1030115722 -3 Left 1030115719 7:106060850-106060872 CCAGTTTCATGGAAGACAATTTT 0: 366
1: 675
2: 884
3: 752
4: 745
Right 1030115722 7:106060870-106060892 TTTTCCATGAACAAGGAGGATGG No data
1030115712_1030115722 21 Left 1030115712 7:106060826-106060848 CCCCAACCTTTCTGGCACCAGGG 0: 49
1: 1059
2: 1604
3: 1321
4: 1109
Right 1030115722 7:106060870-106060892 TTTTCCATGAACAAGGAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030115722 Original CRISPR TTTTCCATGAACAAGGAGGA TGG Intergenic
No off target data available for this crispr