ID: 1030119783

View in Genome Browser
Species Human (GRCh38)
Location 7:106097850-106097872
Sequence TCACATATGTTTACACCTGG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 134}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030119780_1030119783 7 Left 1030119780 7:106097820-106097842 CCTATGAGGACGTAATCTTTCCA 0: 1
1: 0
2: 0
3: 8
4: 87
Right 1030119783 7:106097850-106097872 TCACATATGTTTACACCTGGAGG 0: 1
1: 0
2: 0
3: 9
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030119783 Original CRISPR TCACATATGTTTACACCTGG AGG Exonic
900824676 1:4916863-4916885 TCACATGTATTCCCACCTGGTGG + Intergenic
908719003 1:67102960-67102982 AAACATATGTTTTCACCTGATGG - Intronic
911987688 1:104650847-104650869 TCACACATTTTTACAACTGAAGG - Intergenic
918533252 1:185546484-185546506 TCACACATGTTAACAATTGGTGG + Intergenic
920616664 1:207499316-207499338 TCCCATATGTATGCACCTGATGG + Intronic
921211571 1:212904130-212904152 TCACCTAACTTTACACCTGAAGG + Intergenic
921505550 1:215964441-215964463 TCACCTGTTTTTACACTTGGAGG + Intronic
921609102 1:217190091-217190113 TCACATATGTCTTCACTTGATGG + Intergenic
921800983 1:219401890-219401912 TCAAATATGTAAACACATGGAGG - Intergenic
1063964153 10:11332822-11332844 TCACATGTGTTTACTACTGCTGG + Exonic
1067542942 10:47169508-47169530 TTTCAAATGTTTTCACCTGGTGG + Intergenic
1068476659 10:57535633-57535655 ATACATATGTTTACACAAGGTGG - Intergenic
1069726077 10:70579873-70579895 TCATATTTGTTTTCACCTTGTGG - Intergenic
1071438041 10:85665248-85665270 CCACACATGTTTACAGCTGTGGG + Intronic
1076485466 10:130812919-130812941 TCACACATGTATACACCTGTTGG - Intergenic
1076939101 10:133589910-133589932 TCACAGTTGTATACACTTGGAGG + Intergenic
1079124249 11:17707782-17707804 TCACATATGCTTAGATATGGAGG - Intergenic
1080543668 11:33295035-33295057 TTACATATGTTTATCGCTGGGGG - Intronic
1083646928 11:64177148-64177170 TCACATATGATTATACATGCAGG - Intergenic
1088445603 11:109923910-109923932 TAACATATGATCAAACCTGGAGG - Intergenic
1093849219 12:24015816-24015838 TCACATTTGTTTTCATGTGGTGG + Intergenic
1094394280 12:29989055-29989077 CCTCATATTTTTCCACCTGGAGG - Intergenic
1094404190 12:30097401-30097423 TCACATATATTTTCACATGATGG - Intergenic
1094710028 12:32952702-32952724 TCTCATATCTTTATAACTGGAGG - Intergenic
1095647600 12:44566603-44566625 TGACCTATATTTACAGCTGGGGG + Intronic
1096310027 12:50512597-50512619 GCACATATTTTGACATCTGGTGG + Intronic
1098998445 12:77148774-77148796 TCACATATATTTTCCCCTAGGGG - Intergenic
1099303112 12:80922125-80922147 TAACAGATGTTTACTCCTGTAGG - Intronic
1101591706 12:106130734-106130756 TTTCATATGTATCCACCTGGAGG + Intronic
1107054828 13:36091640-36091662 TCACATATATTTATACCTCTGGG - Intronic
1107289957 13:38840592-38840614 TCAAATATTTTTTAACCTGGGGG + Intronic
1113672440 13:112184187-112184209 TCAGATAAGTTGACTCCTGGGGG + Intergenic
1113672816 13:112186388-112186410 TCAGATACGTTGACACCTGGGGG - Intergenic
1114173438 14:20297434-20297456 TCAGATATGTTTACAAATGCAGG + Intronic
1114882916 14:26809091-26809113 TTACATATGTATATATCTGGTGG - Intergenic
1116198952 14:41765950-41765972 TCATATATCTTTACAAGTGGAGG + Intronic
1116891730 14:50275464-50275486 TCTCATAAGTTCACACATGGTGG - Intronic
1120520926 14:85527697-85527719 TCACATATGCTGACTCATGGTGG + Intergenic
1128025019 15:64428451-64428473 TCCCATATGTTTCCAGCTAGAGG + Intronic
1128244565 15:66124325-66124347 TCACATATTTTTAAACTTGTTGG - Intronic
1131290243 15:91100781-91100803 TCAAACGTGCTTACACCTGGTGG + Intronic
1138165533 16:54798022-54798044 TCACAGATGTGGACACCTGAAGG - Intergenic
1138753931 16:59459238-59459260 GCACACATGTTTACTCCTGGAGG - Intergenic
1141784571 16:86190496-86190518 TCACATATGTGGACACCCAGAGG + Intergenic
1143746131 17:8995573-8995595 CCACATAGGTTTACAGCTGCAGG + Intergenic
1146692472 17:34886088-34886110 TCACATATGTTTTAACAGGGTGG + Intergenic
1149691356 17:58579582-58579604 TCACAGATGTTTAGAGCTGGGGG - Intronic
1150657824 17:67051842-67051864 GCACAGCTGTTTGCACCTGGTGG - Intronic
1155203972 18:23541459-23541481 TCACTTCTGTTTACAGCCGGGGG + Intronic
1155318105 18:24592248-24592270 ACACATATGATTACACCGGTTGG + Intergenic
1159402058 18:67951522-67951544 TCACATTTATTTACACCGAGGGG - Intergenic
925787487 2:7446987-7447009 TCATATATGTGTCCATCTGGTGG + Intergenic
927050047 2:19319335-19319357 TCACAAATGTTTCCAGTTGGAGG - Intergenic
929556879 2:42931102-42931124 TCAGAGATGTGTTCACCTGGTGG - Intergenic
932963031 2:76437729-76437751 TCACATAGGTTTATCACTGGAGG + Intergenic
934569726 2:95361609-95361631 TCCCTGATGTTTACACCTGTTGG - Intronic
940088028 2:149883477-149883499 TCACATATGTGTATTCCTGTGGG + Intergenic
942306039 2:174608591-174608613 TCACATGGGTTTTCCCCTGGGGG - Intronic
943392485 2:187287177-187287199 TCACAAATGCTTAGACATGGAGG - Intergenic
947202536 2:227627503-227627525 TTTAATATGTTTACACATGGAGG - Intronic
947583568 2:231337126-231337148 TCACATATGTCTCCACTTTGGGG + Intronic
1169919409 20:10718503-10718525 TCACATATGCATGCATCTGGTGG + Intergenic
1171076859 20:22136180-22136202 TTTCATATGTTTACACCTCTTGG + Intergenic
1173916880 20:46714463-46714485 TAACAGATGTGTATACCTGGAGG + Intronic
1174995881 20:55567755-55567777 TCATTTATGTTTCCACTTGGGGG - Intergenic
1177241880 21:18468810-18468832 TTACATATGGTACCACCTGGAGG - Intronic
1177612650 21:23471989-23472011 TCAGATGAGTTTCCACCTGGAGG + Intergenic
1180223474 21:46374975-46374997 TCAAATATCTTTGCACCTGTTGG + Intronic
1180606116 22:17060189-17060211 TCAAATATTTTTACCCCAGGTGG + Intergenic
1181105135 22:20569772-20569794 TCACATTTACTTACAGCTGGGGG + Intronic
1181951414 22:26556599-26556621 TCACCTATGTTGTCACCTGGAGG + Intronic
1182597751 22:31435276-31435298 TCACATATGTGTATATATGGAGG + Intronic
1183429828 22:37758858-37758880 TCACAGATGTTTACACATCATGG - Intronic
1183493739 22:38130059-38130081 TCACACATTTCCACACCTGGAGG + Intronic
1184511703 22:44937362-44937384 GCACCTGTGTTCACACCTGGTGG - Intronic
950889274 3:16388407-16388429 TCATAGATGTTTCCACTTGGGGG - Intronic
950940551 3:16885841-16885863 TTACAAATGTTTACACTTCGAGG + Intronic
950965811 3:17145013-17145035 TCACATCTGTTAACTCCTGTTGG - Intergenic
951345229 3:21540403-21540425 GCACATAATATTACACCTGGAGG - Intronic
952856785 3:37778299-37778321 TTACATGTGTTTATACCTGGAGG - Intronic
954974061 3:54676334-54676356 TAGCTTGTGTTTACACCTGGTGG + Intronic
955107693 3:55914699-55914721 TTACATGTGTTTACATCTGCTGG - Intronic
955213406 3:56962889-56962911 TCACATTTGTTTTCACATGGTGG - Intronic
955937040 3:64112057-64112079 GCACACATGGTTCCACCTGGTGG + Intronic
959253081 3:103973386-103973408 TTACATAGGTATACACCTGCTGG + Intergenic
959562668 3:107800297-107800319 CCACATTTGTTTTCACTTGGAGG + Intronic
960646227 3:119887263-119887285 TCTTAGTTGTTTACACCTGGAGG - Intronic
963378345 3:144497880-144497902 AGTCATATGGTTACACCTGGAGG - Intergenic
964245814 3:154652132-154652154 TCACACACATTTACATCTGGAGG + Intergenic
964419332 3:156485083-156485105 TTACATATGTTTACACTTTTAGG + Intronic
966740339 3:183227000-183227022 TCAAATATCTTGAAACCTGGAGG + Intronic
967322074 3:188204567-188204589 TGAAATATTTTTACACCTGTTGG + Intronic
968837040 4:2972638-2972660 CCACATATGACTAGACCTGGTGG - Intronic
969245600 4:5930708-5930730 ACACATATGTTCACTCATGGAGG - Intronic
975644653 4:76534336-76534358 ACACATATGTTTGGACTTGGGGG - Intronic
976415892 4:84774019-84774041 AAACATATTTTTAAACCTGGGGG - Intronic
981072558 4:140559172-140559194 TCACATAATTTTAGAGCTGGAGG - Intergenic
983980853 4:173995353-173995375 ACACATATGTTTACACACGTAGG - Intergenic
984230195 4:177087889-177087911 GCTCATATCTTTACACCTGAAGG + Intergenic
984325797 4:178248934-178248956 TTACATAGGTATACACGTGGTGG + Intergenic
988109758 5:26803897-26803919 ACACATATGTATATACATGGAGG - Intergenic
988141862 5:27253546-27253568 TCACATTTATTCACAACTGGAGG - Intergenic
989322648 5:40154695-40154717 TGAAATAATTTTACACCTGGAGG - Intergenic
991666588 5:69005756-69005778 TCACATGTGGTTATTCCTGGAGG + Intergenic
992723016 5:79579077-79579099 TCACATTTGCTGAAACCTGGAGG + Intergenic
993452387 5:88088303-88088325 TCAATTGTGTTTACAGCTGGAGG - Intergenic
995513542 5:112931462-112931484 TCACATCTGTGTAGGCCTGGAGG - Intergenic
996836616 5:127800934-127800956 TCACATATGTTAACAATTTGGGG - Intergenic
997188434 5:131905061-131905083 TTACATAGGTATACACGTGGTGG - Intronic
998124465 5:139607601-139607623 TTACATATGTTTAGTCCTGTTGG + Intronic
1000815265 5:165913563-165913585 TCACATTTATCTACATCTGGAGG + Intergenic
1003691553 6:8359307-8359329 ACCCATATGTGTACCCCTGGGGG - Intergenic
1003744012 6:8979168-8979190 TTAAATATTTTGACACCTGGTGG - Intergenic
1007470405 6:42086508-42086530 TCACACATGTGCACCCCTGGAGG - Intronic
1008880455 6:56375899-56375921 TCAAATATGTTCATAGCTGGAGG + Intronic
1012940547 6:105410204-105410226 GCACATCTGGTCACACCTGGAGG + Intergenic
1015462226 6:133504642-133504664 TCAAATATGTTTACACTTTAGGG + Intronic
1017405803 6:154116925-154116947 TTACAAATGTATACACCTGAAGG - Intronic
1018465401 6:164039743-164039765 TTAAATATGTTTACATCTGATGG - Intergenic
1027406293 7:77864912-77864934 TTTCATATGTTTCCACCTGTTGG + Intronic
1028795716 7:94900768-94900790 TCAGAAATGTTTAGAACTGGTGG - Intergenic
1029084109 7:97997982-97998004 TTAAATAAGTTTACACATGGGGG + Intergenic
1030119783 7:106097850-106097872 TCACATATGTTTACACCTGGAGG + Exonic
1031633893 7:124078707-124078729 TCTCAGATGTTTACCTCTGGGGG - Intergenic
1036074023 8:5474677-5474699 TCTCTTATATTTACACCTGTGGG + Intergenic
1038871327 8:31497137-31497159 GTACATATGTATACACCTGGGGG - Intergenic
1039288338 8:36067110-36067132 GTACATATGTTTGCAACTGGGGG + Intergenic
1039690312 8:39857582-39857604 TCACCTAAATTTACACCTGAAGG + Intergenic
1039950796 8:42170978-42171000 TCATCTATGCTTACACCTGCAGG - Exonic
1044786764 8:95802416-95802438 CCATATATGGCTACACCTGGGGG - Intergenic
1045024656 8:98075370-98075392 TTTCAAATGTTTACACCAGGAGG + Intronic
1053594331 9:39544581-39544603 TCTCATATCTTTATACCAGGAGG - Intergenic
1053852112 9:42299625-42299647 TCTCATATCTTTATACCAGGAGG - Intergenic
1054571923 9:66820377-66820399 TCTCATATCTTTATACCAGGAGG + Intergenic
1056776081 9:89513675-89513697 TCACACATGTATGCACCTTGGGG + Intergenic
1056921615 9:90795204-90795226 TCACATGTGTTTAAACCCAGCGG - Intergenic
1058037365 9:100267235-100267257 TAACATATGTTTATTCCGGGAGG - Intronic
1186928863 X:14365200-14365222 TCATATATGTGTACCCATGGAGG + Intergenic
1187259816 X:17674707-17674729 ACACATATGTTGGCACCTGCAGG - Intronic
1187515941 X:19970220-19970242 TCACCTGTGTTTCCACCTGGGGG + Exonic
1198634040 X:138675861-138675883 TCACATATGATTCCACCATGTGG + Intronic
1200140168 X:153897045-153897067 TTACATATATTTACCCCAGGAGG + Intronic
1200836966 Y:7741296-7741318 TCATAGATGTTTCCACTTGGCGG - Intergenic
1201920650 Y:19230117-19230139 TCACAAACGATTCCACCTGGAGG + Intergenic