ID: 1030120334

View in Genome Browser
Species Human (GRCh38)
Location 7:106104134-106104156
Sequence TCTACCACAGGGAATTGGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 1, 2: 2, 3: 7, 4: 129}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030120334 Original CRISPR TCTACCACAGGGAATTGGGT AGG (reversed) Intronic
900082712 1:870273-870295 TCTTCCACAGGGGATTGTCTTGG + Intergenic
901570347 1:10155192-10155214 TGTTCCAGAAGGAATTGGGTGGG + Intronic
902167482 1:14584158-14584180 ACGACCCCAGGGAACTGGGTTGG - Intergenic
902530542 1:17087927-17087949 TCTCCCACAGGGAATGTTGTGGG - Intronic
903136144 1:21310505-21310527 TGCACCACAAGGAATTGGGGAGG + Intronic
904665402 1:32116862-32116884 TGTATCTCAGGGAATAGGGTGGG + Intronic
905154525 1:35964274-35964296 TCTACCAGAGGGTAGAGGGTAGG - Intronic
908117389 1:60953387-60953409 TCTTTCACAGGGAACTGGCTTGG - Intronic
910773003 1:90848614-90848636 TCTAGAATATGGAATTGGGTGGG - Intergenic
912159241 1:106960969-106960991 TATAATACAGGGAAGTGGGTTGG - Intergenic
917065444 1:171087705-171087727 TCTATCACCTGGAACTGGGTTGG - Intergenic
919027760 1:192200254-192200276 TCTACCACACGTAATTGTTTGGG + Intergenic
921904751 1:220484732-220484754 TCGACCACATGGATTTGGGGAGG + Intergenic
922683006 1:227616517-227616539 TCTACCTCAGGGAAATTTGTAGG + Intronic
923491887 1:234491463-234491485 CCTAGCAAAAGGAATTGGGTGGG - Intergenic
1066333766 10:34454974-34454996 TCTATCTCAAGGCATTGGGTGGG - Intronic
1073048911 10:100655568-100655590 TTTTCCACTGGGAATTGGGAAGG - Intergenic
1074102287 10:110363306-110363328 TCTACCTCCTGGATTTGGGTGGG - Intergenic
1074388709 10:113038205-113038227 TCTGCGACAGGGTATTAGGTGGG - Intronic
1078306555 11:10193901-10193923 TTTTCCACAGGGAATTGAGTTGG - Exonic
1079152062 11:17908856-17908878 TCTAGCAAAGGGAAATGGATAGG + Intronic
1081091379 11:38870160-38870182 TCTAACACAGGGAATTTTCTTGG + Intergenic
1081755384 11:45540700-45540722 TCTCCCACAGGGAAATGGGAAGG - Intergenic
1082869628 11:57932057-57932079 TCAACCACAGGTAAGTGGGCTGG - Intergenic
1083791749 11:64990188-64990210 TCTACCACAGGGAATTTGGTGGG - Intronic
1084690320 11:70721448-70721470 TCCACCACAGGGAATTGTAGGGG + Intronic
1085881143 11:80467254-80467276 TCTACCTGAGGGTAGTGGGTGGG + Intergenic
1086876281 11:92099619-92099641 TCTACCACAGAAAAATGGTTTGG + Intergenic
1088830646 11:113533434-113533456 TGAAGCACAGGGAATTGGCTTGG + Intergenic
1092112492 12:5973651-5973673 GCCACCCCAGGGAATGGGGTTGG - Intronic
1094808362 12:34111981-34112003 TCTTCCACAGGGGATTGTCTTGG + Intergenic
1099844209 12:88008214-88008236 TCTACCAGAGGGTAGAGGGTTGG - Intronic
1102773735 12:115501063-115501085 TCTGGCAAAGGGAATTGCGTGGG + Intergenic
1106315342 13:28588645-28588667 TGCACCACAGAGAATTGGTTAGG + Intergenic
1110533508 13:76624485-76624507 TCTTCCACAGGTAATTAGATTGG + Intergenic
1113886764 13:113665103-113665125 TCTCCCACGTGGAATGGGGTGGG + Intergenic
1114030979 14:18581069-18581091 TCTTCCACAGGGGATTGTCTTGG - Intergenic
1121171053 14:91854822-91854844 TCTAGCAGAGGCAATGGGGTGGG - Intronic
1121478221 14:94234652-94234674 TATAGCCCAGGGCATTGGGTAGG + Exonic
1126054506 15:44717030-44717052 TCTAGAACAGGGAATTGATTTGG + Intronic
1128977831 15:72166519-72166541 TCCAGCACAGGGAATGGGGCAGG - Intronic
1130880905 15:88055130-88055152 TCTACCACAGGGCCTGGGATTGG - Intronic
1134597198 16:15505218-15505240 TCTACAACAGGGGATGGGATAGG + Intronic
1136532149 16:30876866-30876888 TCTACCATAAGGAACTTGGTGGG + Intronic
1139418992 16:66836931-66836953 TTTACCATAGGGCACTGGGTGGG + Intronic
1143260688 17:5596214-5596236 TCCATCACAGGGAATTTGATAGG - Intronic
1145943698 17:28758132-28758154 TCTAAGAAAGGGAATTTGGTGGG - Exonic
1148559465 17:48597627-48597649 TCTCCCACAGGGTGCTGGGTGGG - Intronic
1148647106 17:49225441-49225463 TCTACCTCAGGGAATGAGGGAGG - Intronic
1149969501 17:61202357-61202379 TCTATCACAGCGAATAAGGTTGG + Intronic
1150227003 17:63529712-63529734 TCTACCCCATGGAGCTGGGTTGG - Intronic
1150351815 17:64451081-64451103 TCCACCACTGGGGAGTGGGTGGG - Intronic
1153212590 18:2784096-2784118 TCTAACAGAGGAAACTGGGTTGG + Intronic
1155080916 18:22408842-22408864 TCTGCCACAGGGAACAGGGCAGG - Intergenic
1156823698 18:41404596-41404618 TCTGCTACAGGGATTGGGGTTGG + Intergenic
1161484689 19:4529010-4529032 TGTACCACAGGGGATGGGGACGG + Exonic
1161946706 19:7441845-7441867 TCTACGGGAGGGAATTGGGGTGG + Intronic
1166393499 19:42423316-42423338 ACTGCCACAGGGAGTTGGGGGGG - Intronic
1166627108 19:44367789-44367811 TCTACTAAAGGGATTTGGGTGGG - Intronic
925438249 2:3860156-3860178 TCTACCACAGTGATATGGTTTGG - Intergenic
931265572 2:60657184-60657206 TCTAGCAGGGGGAAATGGGTAGG - Intergenic
931907701 2:66860357-66860379 TTTACCTCAGGAAATTGGCTGGG + Intergenic
935493690 2:103752216-103752238 TCCACCAAGAGGAATTGGGTGGG + Intergenic
937441993 2:121923695-121923717 TCTACCAGAGGGCAGAGGGTGGG - Intergenic
938497226 2:131804705-131804727 TCTTCCACAGGGGATTGTCTTGG + Intergenic
938546391 2:132336738-132336760 TCTACTAAAGGGAAGTGGGTGGG + Intergenic
939661218 2:144892396-144892418 TCTACCAAAGAGAATTTGCTAGG + Intergenic
939720848 2:145649148-145649170 TGTACCACAGGGACTAGGCTGGG - Intergenic
940490397 2:154351798-154351820 TCTATCACAAGGAATAGTGTAGG + Intronic
941424605 2:165326602-165326624 TCTATCCCAGGGATTTGGGCTGG - Intronic
941457080 2:165721869-165721891 TCTAAGACAGGGCATTGGGGTGG + Intergenic
943013764 2:182485357-182485379 TCTACCTGAGGGCAATGGGTGGG + Intronic
945186807 2:207147687-207147709 TTTCTCAGAGGGAATTGGGTGGG - Intronic
946894522 2:224309908-224309930 GCCTCCACAGGGATTTGGGTTGG + Intergenic
1168801321 20:645273-645295 TCTACCACGGTCAAGTGGGTGGG + Intergenic
1168852523 20:986300-986322 TCTAACACCGGGAATTGTGGAGG + Intronic
1169350382 20:4863638-4863660 TCTAACACATGAAATTGGGGAGG + Intronic
1170952577 20:20950293-20950315 ATTACCACAGGGACCTGGGTTGG - Intergenic
1171875249 20:30569470-30569492 TCTACTAAAGGGAATTGGGTGGG + Intergenic
1171948583 20:31400635-31400657 TCTAGCAATGGGAAGTGGGTGGG - Intergenic
1173025666 20:39305374-39305396 CCTACCTCAGGGCATGGGGTTGG + Intergenic
1173270639 20:41531647-41531669 TCTACCACAGAAACTTGGGTGGG - Intronic
1175865791 20:62175695-62175717 TTTTTCTCAGGGAATTGGGTAGG + Intronic
1180455092 22:15508127-15508149 TCTTCCACAGGGGATTGTCTTGG - Intergenic
950821134 3:15760093-15760115 TATACCACAGGTAGTTGGGCTGG - Intronic
951854379 3:27178879-27178901 TCTACCACTGGGTAGGGGGTGGG - Intronic
954404429 3:50337572-50337594 CCTACCACAGGGAACGGGGGCGG + Intronic
954979442 3:54731026-54731048 TCTACCACACAGAACTAGGTTGG + Intronic
958746165 3:98137782-98137804 TTTACCACAGAGAAGTGGGAAGG + Intergenic
959912936 3:111784856-111784878 TTTACAATAGGGAATTGGTTAGG - Intronic
960377024 3:116915706-116915728 TCTACCCCTGGGAATTCTGTGGG - Intronic
960396148 3:117139769-117139791 TCTATCACTGGAAATTGTGTGGG - Intergenic
960726166 3:120672491-120672513 TCTACCTCAGTGAGTTGAGTTGG + Intronic
961073200 3:123956644-123956666 TCTACCCCAGAAAATTAGGTAGG - Intronic
965963774 3:174460742-174460764 TCAACAACAGAGAAATGGGTAGG - Intronic
968291489 3:197542947-197542969 TCTTCCACAGGGCCTTGGGGAGG - Intronic
972904736 4:43730895-43730917 TCTACCAGAGGGCACAGGGTGGG + Intergenic
978884701 4:113753511-113753533 TCTAGCATAGGGAAATTGGTAGG - Intronic
981472051 4:145147409-145147431 TTTACCACTGGGATTTGGGAAGG - Intronic
982166693 4:152619806-152619828 TCTCCCACACGGCATTGGCTGGG - Exonic
982238168 4:153272029-153272051 TCTACCACCAGCTATTGGGTGGG - Intronic
983606523 4:169592599-169592621 TTTACCTCAGGGAAGTGGATTGG + Intronic
990007188 5:50957317-50957339 TCTAACTCAGGGAATTAGGAAGG - Intergenic
990016011 5:51063689-51063711 TCTCCCACAGGGAACTAGGCAGG - Intergenic
995532708 5:113107084-113107106 TCTCCAACAGAGAATAGGGTAGG + Intronic
995560851 5:113380115-113380137 TCTACAGCAGGGAGCTGGGTTGG - Intronic
997640070 5:135443181-135443203 TGTAATTCAGGGAATTGGGTAGG - Intergenic
999127196 5:149254427-149254449 TCTACCACAGGGTCTGGGCTGGG + Intronic
1001265252 5:170269401-170269423 TCTTCCACAGGGAAAAGGGTAGG + Intronic
1001882830 5:175259536-175259558 TCTCCTCCAGGGAAATGGGTTGG - Intergenic
1001913400 5:175539937-175539959 TCTCCCACAGGGACTAGGGATGG + Intergenic
1005436097 6:25813724-25813746 TCTACCACTGGGTAGAGGGTGGG - Intronic
1007957198 6:45929011-45929033 TCCACCACATGGAATGGTGTTGG + Intronic
1012191779 6:96288244-96288266 TCTCCCACAGGAACTTGGGGTGG + Intergenic
1018494203 6:164331668-164331690 TCTACCATAGAGATGTGGGTTGG - Intergenic
1019196702 6:170287379-170287401 TCTACAGCTGGGGATTGGGTAGG - Intronic
1019935652 7:4255638-4255660 TCTTCAACATGGAGTTGGGTTGG + Intronic
1023447955 7:40251541-40251563 CCTAGCATAGGGAATTGGCTGGG - Intronic
1026300619 7:69094779-69094801 TCCAACACTGGGAATTGGGCAGG + Intergenic
1028269595 7:88772428-88772450 TCTTCCACAGGGAATAGAGAAGG + Intronic
1028411032 7:90530583-90530605 TCTACACCAGGGAATAGGGAAGG - Intronic
1030120334 7:106104134-106104156 TCTACCACAGGGAATTGGGTAGG - Intronic
1032495490 7:132358646-132358668 TCTATGACAGTGACTTGGGTAGG + Intronic
1032507118 7:132443969-132443991 TCCACCTCAGTGAACTGGGTGGG + Intronic
1034094320 7:148392605-148392627 CCTCCAACAGGGAAGTGGGTAGG + Intronic
1045107098 8:98903168-98903190 TATAGCACAGGGAAATGGCTAGG + Intronic
1045633225 8:104151831-104151853 TCTTCCACAGGGCATTGTCTTGG - Intronic
1046300699 8:112283680-112283702 TTTTCAACAGGGAATTGGTTAGG - Intronic
1052857897 9:33418361-33418383 TCTACCACAGGGCACTGGCTGGG - Intergenic
1053150408 9:35739544-35739566 CCTACCCCAGGGTATTGGTTAGG - Intronic
1054883765 9:70173673-70173695 ACTACTACAGGGAATTCTGTGGG + Intronic
1055062731 9:72087318-72087340 TGTAAGACAGGGATTTGGGTAGG - Intergenic
1055573330 9:77639213-77639235 TCTACCATAGGGAAAGGGGGTGG - Intronic
1062515799 9:136934892-136934914 TTCAACACAGGAAATTGGGTGGG - Intronic
1193205948 X:78747597-78747619 TGGAGCACAGGGAATTGGGCGGG + Intergenic
1196927459 X:120647623-120647645 CCTCACACAGGGAATTGGTTGGG - Intergenic
1197772141 X:130095961-130095983 TCTACCACAGAGAATAGGGTGGG - Intronic
1198694296 X:139319535-139319557 ACTTCCACAGGGACTAGGGTGGG - Intergenic
1200275475 X:154728314-154728336 TCTGCCAAAAGGAATTGTGTGGG + Intronic
1201259521 Y:12144976-12144998 TCTAACACTGGGATTTGGGCTGG - Intergenic