ID: 1030121057

View in Genome Browser
Species Human (GRCh38)
Location 7:106111770-106111792
Sequence TCTAACCGAAACCCGGCGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030121057_1030121070 27 Left 1030121057 7:106111770-106111792 CCGGCCGCCGGGTTTCGGTTAGA No data
Right 1030121070 7:106111820-106111842 GCGGGAGGCAGTGGAGCCAAGGG 0: 1
1: 0
2: 1
3: 19
4: 291
1030121057_1030121064 12 Left 1030121057 7:106111770-106111792 CCGGCCGCCGGGTTTCGGTTAGA No data
Right 1030121064 7:106111805-106111827 GTTTTCCCTTCCTCTGCGGGAGG No data
1030121057_1030121063 9 Left 1030121057 7:106111770-106111792 CCGGCCGCCGGGTTTCGGTTAGA No data
Right 1030121063 7:106111802-106111824 GAAGTTTTCCCTTCCTCTGCGGG No data
1030121057_1030121062 8 Left 1030121057 7:106111770-106111792 CCGGCCGCCGGGTTTCGGTTAGA No data
Right 1030121062 7:106111801-106111823 GGAAGTTTTCCCTTCCTCTGCGG 0: 1
1: 0
2: 4
3: 16
4: 220
1030121057_1030121071 28 Left 1030121057 7:106111770-106111792 CCGGCCGCCGGGTTTCGGTTAGA No data
Right 1030121071 7:106111821-106111843 CGGGAGGCAGTGGAGCCAAGGGG 0: 1
1: 0
2: 2
3: 34
4: 326
1030121057_1030121069 26 Left 1030121057 7:106111770-106111792 CCGGCCGCCGGGTTTCGGTTAGA No data
Right 1030121069 7:106111819-106111841 TGCGGGAGGCAGTGGAGCCAAGG 0: 1
1: 0
2: 1
3: 35
4: 396
1030121057_1030121067 18 Left 1030121057 7:106111770-106111792 CCGGCCGCCGGGTTTCGGTTAGA No data
Right 1030121067 7:106111811-106111833 CCTTCCTCTGCGGGAGGCAGTGG 0: 1
1: 0
2: 7
3: 37
4: 398

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030121057 Original CRISPR TCTAACCGAAACCCGGCGGC CGG (reversed) Intronic