ID: 1030122389

View in Genome Browser
Species Human (GRCh38)
Location 7:106122744-106122766
Sequence CTGCAGGGTTAGAATTAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030122389_1030122395 15 Left 1030122389 7:106122744-106122766 CCCTCCTAATTCTAACCCTGCAG No data
Right 1030122395 7:106122782-106122804 CACCAAGATCAGATTCTGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030122389 Original CRISPR CTGCAGGGTTAGAATTAGGA GGG (reversed) Intergenic
No off target data available for this crispr