ID: 1030127214

View in Genome Browser
Species Human (GRCh38)
Location 7:106165615-106165637
Sequence GCAGTTCTGCTGGTCTCTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030127214_1030127221 16 Left 1030127214 7:106165615-106165637 CCAACAGAGACCAGCAGAACTGC No data
Right 1030127221 7:106165654-106165676 TAGCCACCTCCCCAGCTGACTGG No data
1030127214_1030127226 26 Left 1030127214 7:106165615-106165637 CCAACAGAGACCAGCAGAACTGC No data
Right 1030127226 7:106165664-106165686 CCCAGCTGACTGGCAGATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030127214 Original CRISPR GCAGTTCTGCTGGTCTCTGT TGG (reversed) Intergenic
No off target data available for this crispr