ID: 1030127226

View in Genome Browser
Species Human (GRCh38)
Location 7:106165664-106165686
Sequence CCCAGCTGACTGGCAGATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030127218_1030127226 -1 Left 1030127218 7:106165642-106165664 CCCTGCCTAGACTAGCCACCTCC No data
Right 1030127226 7:106165664-106165686 CCCAGCTGACTGGCAGATGAAGG No data
1030127215_1030127226 16 Left 1030127215 7:106165625-106165647 CCAGCAGAACTGCCCAGCCCTGC No data
Right 1030127226 7:106165664-106165686 CCCAGCTGACTGGCAGATGAAGG No data
1030127219_1030127226 -2 Left 1030127219 7:106165643-106165665 CCTGCCTAGACTAGCCACCTCCC No data
Right 1030127226 7:106165664-106165686 CCCAGCTGACTGGCAGATGAAGG No data
1030127217_1030127226 3 Left 1030127217 7:106165638-106165660 CCAGCCCTGCCTAGACTAGCCAC No data
Right 1030127226 7:106165664-106165686 CCCAGCTGACTGGCAGATGAAGG No data
1030127220_1030127226 -6 Left 1030127220 7:106165647-106165669 CCTAGACTAGCCACCTCCCCAGC No data
Right 1030127226 7:106165664-106165686 CCCAGCTGACTGGCAGATGAAGG No data
1030127214_1030127226 26 Left 1030127214 7:106165615-106165637 CCAACAGAGACCAGCAGAACTGC No data
Right 1030127226 7:106165664-106165686 CCCAGCTGACTGGCAGATGAAGG No data
1030127216_1030127226 4 Left 1030127216 7:106165637-106165659 CCCAGCCCTGCCTAGACTAGCCA No data
Right 1030127226 7:106165664-106165686 CCCAGCTGACTGGCAGATGAAGG No data
1030127213_1030127226 27 Left 1030127213 7:106165614-106165636 CCCAACAGAGACCAGCAGAACTG No data
Right 1030127226 7:106165664-106165686 CCCAGCTGACTGGCAGATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030127226 Original CRISPR CCCAGCTGACTGGCAGATGA AGG Intergenic
No off target data available for this crispr