ID: 1030133079

View in Genome Browser
Species Human (GRCh38)
Location 7:106219576-106219598
Sequence AAGTGAAATCTTGGGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030133079_1030133087 29 Left 1030133079 7:106219576-106219598 CCTTCCTCCCCAAGATTTCACTT No data
Right 1030133087 7:106219628-106219650 CTTGCACTTGGCATGTTTACTGG No data
1030133079_1030133088 30 Left 1030133079 7:106219576-106219598 CCTTCCTCCCCAAGATTTCACTT No data
Right 1030133088 7:106219629-106219651 TTGCACTTGGCATGTTTACTGGG No data
1030133079_1030133085 17 Left 1030133079 7:106219576-106219598 CCTTCCTCCCCAAGATTTCACTT No data
Right 1030133085 7:106219616-106219638 CTGTGTAGTTACCTTGCACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030133079 Original CRISPR AAGTGAAATCTTGGGGAGGA AGG (reversed) Intergenic
No off target data available for this crispr