ID: 1030133122

View in Genome Browser
Species Human (GRCh38)
Location 7:106219954-106219976
Sequence TCTAAATCACAGAACTAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030133122_1030133126 -10 Left 1030133122 7:106219954-106219976 CCCTCCTAGTTCTGTGATTTAGA No data
Right 1030133126 7:106219967-106219989 GTGATTTAGATTGACCATGAGGG No data
1030133122_1030133129 4 Left 1030133122 7:106219954-106219976 CCCTCCTAGTTCTGTGATTTAGA No data
Right 1030133129 7:106219981-106220003 CCATGAGGGCAAGGTAATAGAGG No data
1030133122_1030133132 16 Left 1030133122 7:106219954-106219976 CCCTCCTAGTTCTGTGATTTAGA No data
Right 1030133132 7:106219993-106220015 GGTAATAGAGGAGGAAGGTGAGG No data
1030133122_1030133131 11 Left 1030133122 7:106219954-106219976 CCCTCCTAGTTCTGTGATTTAGA No data
Right 1030133131 7:106219988-106220010 GGCAAGGTAATAGAGGAGGAAGG No data
1030133122_1030133127 -5 Left 1030133122 7:106219954-106219976 CCCTCCTAGTTCTGTGATTTAGA No data
Right 1030133127 7:106219972-106219994 TTAGATTGACCATGAGGGCAAGG No data
1030133122_1030133130 7 Left 1030133122 7:106219954-106219976 CCCTCCTAGTTCTGTGATTTAGA No data
Right 1030133130 7:106219984-106220006 TGAGGGCAAGGTAATAGAGGAGG No data
1030133122_1030133133 21 Left 1030133122 7:106219954-106219976 CCCTCCTAGTTCTGTGATTTAGA No data
Right 1030133133 7:106219998-106220020 TAGAGGAGGAAGGTGAGGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030133122 Original CRISPR TCTAAATCACAGAACTAGGA GGG (reversed) Intergenic
No off target data available for this crispr