ID: 1030137220

View in Genome Browser
Species Human (GRCh38)
Location 7:106266279-106266301
Sequence AAGGATACTGTATGTGGGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 181}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030137220 Original CRISPR AAGGATACTGTATGTGGGCA AGG (reversed) Intronic
901427385 1:9191051-9191073 ATGGAAGCTGCATGTGGGCATGG + Intergenic
906451713 1:45955123-45955145 AATTAAACTGTATGAGGGCAGGG - Intronic
908219920 1:61994847-61994869 AAGAATCCTGTATATGGGCTGGG - Intronic
910219209 1:84873286-84873308 AGGGATACTGTGTGTGGGAGGGG + Intronic
910455370 1:87392104-87392126 AAGGCTACTGACTGTGGGCCAGG + Intergenic
911732609 1:101306463-101306485 AAAGATACTGGATATAGGCAGGG - Intergenic
916844077 1:168630541-168630563 TAGGATAATGTGTGTGTGCAGGG + Intergenic
917406586 1:174713097-174713119 AATGATATAGTATGGGGGCAAGG - Intronic
917653367 1:177101447-177101469 AAGCAAACTTTTTGTGGGCATGG - Intronic
920025587 1:202992228-202992250 AATTTTACTGTATGTGTGCATGG + Intergenic
921451084 1:215306488-215306510 AAGGATACTGCAAGAGAGCAAGG + Intergenic
924010659 1:239661888-239661910 AAGGAAACTGTGTGTGAGAAGGG + Intronic
924291602 1:242542425-242542447 AAGGGTGGTGTATGTGGGCAAGG - Intergenic
1064567679 10:16658901-16658923 AACAATACAGTTTGTGGGCAAGG - Intronic
1070322253 10:75363037-75363059 CAGGAGTCTGTGTGTGGGCATGG + Intergenic
1073459140 10:103655967-103655989 AAGTATACTGTATGTAGGAGTGG - Intronic
1079607014 11:22382538-22382560 AATGATGCTGAATATGGGCAGGG - Intergenic
1079692950 11:23442582-23442604 AAGTATGCTTTATGTGAGCAAGG - Intergenic
1083088442 11:60175002-60175024 AAGGAAACAGTATGTGTGCATGG - Intronic
1083795792 11:65015908-65015930 AAGGCCACTGTATGATGGCAGGG + Intronic
1083991663 11:66249910-66249932 AAGGATACTCTATGCGAGGAAGG - Intergenic
1087893950 11:103566636-103566658 ATGTAAACTGTATGTGGGCAGGG + Intergenic
1088855181 11:113743873-113743895 ACTGATACGGCATGTGGGCAAGG + Exonic
1089427359 11:118390057-118390079 AAGGAGATTTTATCTGGGCAAGG + Intronic
1090387735 11:126366326-126366348 CTGGAAGCTGTATGTGGGCATGG + Intronic
1090390303 11:126383516-126383538 CCGGAAGCTGTATGTGGGCATGG + Intronic
1092011425 12:5116066-5116088 AAGGAGACTTTATGGGAGCAGGG - Intergenic
1092796795 12:12119267-12119289 AAGGATTCAGAATTTGGGCAAGG - Exonic
1095170228 12:39026503-39026525 AAGGAGACTGTATGGAGGCCGGG + Intergenic
1096001000 12:48130500-48130522 AAGGACACAGAATGTGGGAAGGG - Intronic
1096390823 12:51227686-51227708 AAGAATACAGGATGTGGGCTGGG - Intergenic
1098030011 12:66243712-66243734 AAGGAAACTGTGGGTGGTCATGG + Intronic
1099076551 12:78116185-78116207 GAGGATACTGTATGTTATCATGG + Intronic
1100442188 12:94627431-94627453 AAAGAAATTGTAGGTGGGCATGG - Intronic
1102069028 12:110002073-110002095 AAGAATACAGGATTTGGGCAAGG - Intronic
1104165022 12:126219619-126219641 AAGGATACTGCTTGAGGACATGG - Intergenic
1105061741 12:133158945-133158967 AGGTATGTTGTATGTGGGCATGG - Exonic
1106172465 13:27299825-27299847 ATGGACATTGTATCTGGGCATGG + Intergenic
1106506677 13:30376532-30376554 CAGCATACTGTATGTGCTCAGGG + Intergenic
1114967770 14:27984650-27984672 AAGAATACTGACTGTGGGCCGGG + Intergenic
1116609213 14:47045771-47045793 AAGGTTACTGCATGTTGGCCAGG - Intronic
1117133749 14:52712513-52712535 AAGGATACTGCATGTATACATGG - Intronic
1117596635 14:57332558-57332580 AAGGAGGCTGTGTGTGTGCAAGG + Intergenic
1118806310 14:69240160-69240182 GAGGAGAGTGTGTGTGGGCAGGG + Intronic
1122000034 14:98640283-98640305 AAGGGAACTGTATAAGGGCATGG - Intergenic
1122190713 14:100040810-100040832 AAGAATAATAAATGTGGGCATGG + Intronic
1123046325 14:105518224-105518246 AAGAAGACTGTATGAGGACAGGG - Intergenic
1125186986 15:36942131-36942153 AAGGATTCTGGATGAGGGCTGGG + Intronic
1126741827 15:51785115-51785137 AAGAATACTTTATTTGGGCCGGG + Intronic
1126869075 15:52968429-52968451 AAGGTTAGAGTATGTGGGGAGGG - Intergenic
1127577184 15:60303292-60303314 AAGGATGCTGAAGTTGGGCATGG - Intergenic
1128756070 15:70185013-70185035 AAGGTCACTGCATCTGGGCAAGG + Intergenic
1129224454 15:74159867-74159889 AACAATACTGTGTGAGGGCATGG - Intergenic
1129743387 15:78001151-78001173 AAGGAAACAGTATGGGGACAGGG - Intronic
1132089461 15:98936073-98936095 AAGGGGACTGTGTGTGGGGAGGG - Intronic
1133356625 16:5141641-5141663 AAGATGACTGTATGGGGGCATGG + Intergenic
1133395886 16:5447161-5447183 AAGGTTATTGTAGGTGGGGAGGG - Intergenic
1134903753 16:17961594-17961616 AAGGATACAGTAAGGGGACATGG + Intergenic
1135590661 16:23702680-23702702 AATGACGCTGTATGTGGGGAAGG - Exonic
1136361400 16:29782275-29782297 AAGGATATGGTAGTTGGGCAAGG + Exonic
1137970756 16:52982489-52982511 AGGAATAATCTATGTGGGCATGG + Intergenic
1140658959 16:77168979-77169001 ACGCATACTGTATGTGGGTGTGG + Intergenic
1141531028 16:84647349-84647371 AAAGATCCTGTAAGTGGGCTGGG + Intergenic
1141793514 16:86252745-86252767 AAGGACAGTGTATGAGGGCCCGG - Intergenic
1144134566 17:12281134-12281156 AAGGACAGTGTAAGTGTGCAAGG + Intergenic
1145356309 17:22157616-22157638 AATGATCTTGTATCTGGGCATGG - Intergenic
1146816530 17:35946976-35946998 AAGGAAACTTTTTGTGGGAACGG + Intergenic
1149420406 17:56504966-56504988 AAAGATACTTTAAGTGGGCTGGG - Intronic
1151626583 17:75280025-75280047 TAGGATACTGTTAGTGGGAAAGG - Intronic
1153910790 18:9705013-9705035 AAGGAGCCTGTCTGTGGGAAAGG - Intergenic
1154324664 18:13381356-13381378 AAGGATACAGTGGGCGGGCACGG - Intronic
1154939817 18:21100714-21100736 AAGGAGACTGCATGTAGGGAGGG + Intronic
1156457125 18:37301117-37301139 GAGGATACTCCAAGTGGGCAGGG + Intronic
1158028775 18:52937006-52937028 AAGTATAGTGTATTTGAGCAGGG + Intronic
1158071711 18:53478098-53478120 AAGGATACAGAATTGGGGCAAGG + Intronic
1159144260 18:64433208-64433230 AAACATACTATCTGTGGGCAAGG + Intergenic
1159470562 18:68849979-68850001 AAGGATAATTTATATGGGCCAGG + Intronic
1160129258 18:76209847-76209869 AAGAATGCTTTTTGTGGGCAGGG - Intergenic
1163710812 19:18845708-18845730 AAGCATCCTGGTTGTGGGCATGG + Intronic
1164639653 19:29814657-29814679 AAAAATTCTGTATGTGAGCAGGG - Intronic
1168593074 19:57652693-57652715 AAGGGTTTTGGATGTGGGCATGG - Intergenic
925682962 2:6442422-6442444 AGGGATGCTGTCTGTGGTCAGGG + Intergenic
926414434 2:12634985-12635007 AAGGAGACAGTATGTGGGGCAGG + Intergenic
927554841 2:24024169-24024191 AAGGATCATGCAGGTGGGCACGG - Exonic
928671296 2:33606216-33606238 CTGGATAGTGTGTGTGGGCATGG + Intergenic
931852090 2:66262140-66262162 AAGGATATTGGATGAGGGCAGGG - Intergenic
931906364 2:66847695-66847717 AAAAATAATGTATGTGGGCCAGG - Intergenic
932242490 2:70168270-70168292 AAGGATCCTATAGCTGGGCATGG - Intronic
932996397 2:76859186-76859208 AAGGATACTGGTTGAGTGCAAGG + Intronic
935105118 2:100035344-100035366 AAGAATACTGTTGGTGTGCAAGG + Intronic
939827293 2:147030087-147030109 AAGGATAATGTGTGTTGGCGTGG + Intergenic
940105868 2:150099346-150099368 AAGAATACTGTATCAGGGCTGGG - Intergenic
940890983 2:159035017-159035039 AAGGCTACTGTATGTGTTCATGG - Intronic
941854695 2:170219165-170219187 AAGGAGCCTCAATGTGGGCAAGG - Intronic
946128020 2:217581432-217581454 ATGGAAACTGTTTGGGGGCAGGG - Intronic
947294725 2:228617800-228617822 CAGGATAAGGTATGTGGGAAGGG - Intergenic
948601460 2:239109677-239109699 CAGTACACTGTGTGTGGGCATGG + Intronic
948704261 2:239779337-239779359 ATGGATGCTGTGTGTGGCCAGGG - Intronic
1169461211 20:5797263-5797285 AAGAATAATGTGTGTGGGCTGGG + Intronic
1170111654 20:12810488-12810510 AAGGATAGTTTTTATGGGCATGG - Intergenic
1173021484 20:39271320-39271342 CAGGATCCTGGATGTGGGCGTGG + Intergenic
1173690174 20:44954647-44954669 AAGGATATGGTTTGTGGACATGG - Intronic
1174744815 20:53051046-53051068 AAGCATATTGTAGCTGGGCATGG + Intronic
1176974462 21:15303852-15303874 ACTGATACTTTATGTAGGCATGG + Intergenic
1178769831 21:35492899-35492921 GTGGAAAGTGTATGTGGGCAGGG - Intronic
1179169647 21:38962883-38962905 AATGAAACTGTATTTGGACATGG + Intergenic
1185390725 22:50560191-50560213 AAGATTACAGTATTTGGGCATGG + Intronic
949889492 3:8723081-8723103 AAGGATTGTGAATGTGGGCCTGG - Intronic
952393426 3:32900424-32900446 TAGGATACTGCCTGTGGTCATGG - Intergenic
953128160 3:40111580-40111602 AAGGATGCTGAAGGTGGCCAGGG + Intronic
956486637 3:69729786-69729808 AAGGAAGTTGTAAGTGGGCAAGG + Intergenic
959269810 3:104192749-104192771 AATGATACAGAAAGTGGGCAGGG - Intergenic
960618580 3:119618420-119618442 GAGGAACCTGTATGTGGGAAGGG - Intronic
961240038 3:125402744-125402766 AAGGAAACTGTGTCTTGGCAAGG - Intergenic
961780903 3:129319536-129319558 AAGGAAACTGTAGGTGGGGAAGG + Intergenic
961871372 3:129990843-129990865 AAGGACTCTGTGTGTGGGGAGGG + Intergenic
962321848 3:134396877-134396899 AAAGATACTTTATGGGGTCACGG - Intergenic
962369575 3:134810020-134810042 CAGGATGCAGTATGTGAGCAAGG - Intronic
964691128 3:159451100-159451122 AAGAATACTAAATGTGGGCCGGG - Intronic
964741987 3:159975904-159975926 AAGGAAACTGGACGTTGGCAAGG - Intergenic
965874374 3:173299395-173299417 AAGACTACTGGATGAGGGCAGGG + Intergenic
965984960 3:174740122-174740144 AAACATAATGCATGTGGGCAAGG + Intronic
968451408 4:677713-677735 AAGGATTCTGTGTGTCAGCAGGG - Intronic
970102150 4:12537028-12537050 AATGATACTGGATGGGAGCATGG - Intergenic
970630920 4:17943644-17943666 AAGGATAAAGTAAGTGGACATGG + Intronic
971471802 4:27034571-27034593 AAGAATAATATATGTTGGCATGG - Intergenic
974855751 4:67458809-67458831 AAGGAAACTGTATGTGGGGTGGG + Intergenic
975051839 4:69875012-69875034 AAGGATACTCTATGTAGAAATGG + Intergenic
976368082 4:84253484-84253506 AAGGATACTGGATTTGGGCCAGG + Intergenic
976806030 4:89047977-89047999 AACAATACTATATGTTGGCAAGG + Intronic
977818878 4:101448757-101448779 AAAGGTACTGTATGTGGGGAAGG + Intronic
977849054 4:101802153-101802175 AATGATACTGAAAGTGGGAAGGG - Intronic
978267750 4:106846826-106846848 AGGGATACTCTATGTAGTCAGGG - Intergenic
979938136 4:126723073-126723095 AAGGTTACTAAAGGTGGGCAGGG + Intergenic
980045571 4:127984560-127984582 AAGAATACTATTTGTGGGCCAGG + Intronic
980235002 4:130093638-130093660 AAGGATACTTTATCTGTGCCAGG - Intergenic
985422236 4:189795773-189795795 GAGGATGCTGGATGTGGGCAAGG - Intergenic
986524977 5:8664087-8664109 TAGGATCCTGTATGTTGGAATGG + Intergenic
986728851 5:10620000-10620022 AGGGACAGTGTAGGTGGGCATGG + Intronic
988830122 5:34978856-34978878 GAGGTTACTGTGTCTGGGCAGGG - Intergenic
989653159 5:43716001-43716023 AAGAATAGTGTATGTGTCCAGGG - Intergenic
990279359 5:54232821-54232843 AAGGATGGTGTATGAGGGCAGGG - Intronic
990852540 5:60223407-60223429 AACAATACTGAATGAGGGCATGG + Intronic
991337126 5:65561638-65561660 AAGGATACAAAATGTGGGAACGG - Intronic
994264197 5:97695427-97695449 AAGGATAGTGGGTGAGGGCAAGG + Intergenic
994401452 5:99285345-99285367 AAGGAGACTGCACGAGGGCATGG - Intergenic
995440336 5:112184721-112184743 TTGGATGCTGGATGTGGGCAGGG + Intronic
997641824 5:135454109-135454131 AAGGATTCTTTATCTGGGCATGG - Intergenic
1001132614 5:169077240-169077262 AAGAATACAGTATGTAGGCCGGG + Intronic
1001231280 5:169990837-169990859 CATGATACTGCCTGTGGGCATGG + Intronic
1002404268 5:179017252-179017274 AAGGATAGTGGATGTGGTAATGG - Intergenic
1003325909 6:5090639-5090661 AAGGACACTGCATGAGGGGACGG - Intergenic
1003621709 6:7706565-7706587 AAGGAAGGTGTGTGTGGGCAAGG - Intergenic
1005281323 6:24277685-24277707 AATCATAATGAATGTGGGCAAGG + Intronic
1006789402 6:36689441-36689463 AAGGATACGGTATCTGATCATGG + Intergenic
1007481426 6:42152882-42152904 AAGGAGGCTGTGTGTGTGCAAGG + Intergenic
1011266640 6:85527563-85527585 AAAAATACTTTATTTGGGCATGG - Intronic
1013097982 6:106963266-106963288 TTGGATACTGTATGAGGTCATGG - Intergenic
1013192594 6:107816335-107816357 AAGGAAACAGTATGTGGAAAAGG - Intronic
1013289307 6:108707019-108707041 CAAGTTTCTGTATGTGGGCAGGG - Intergenic
1014548875 6:122764707-122764729 AAGGGTCTTGCATGTGGGCAGGG - Intergenic
1015231646 6:130921604-130921626 CAGTATTCTGGATGTGGGCAGGG - Intronic
1016094310 6:140017154-140017176 AGGGCTAGTGTATATGGGCAGGG + Intergenic
1016116740 6:140295664-140295686 AAAAATAATGTATGTTGGCAAGG + Intergenic
1016954040 6:149609203-149609225 AAGTATAATGTGTGTTGGCATGG - Intronic
1021240332 7:18192599-18192621 AAGGATATAGTATTTGGGGATGG + Intronic
1021444548 7:20718202-20718224 AATGTTACTGTATTTGGGCCAGG - Intronic
1027931861 7:84546889-84546911 CATGATACTGCAGGTGGGCAGGG - Intergenic
1028531718 7:91845673-91845695 TAGGATCCTGAATATGGGCAAGG + Intronic
1030137220 7:106266279-106266301 AAGGATACTGTATGTGGGCAAGG - Intronic
1031401416 7:121329375-121329397 AAGGAAACTGGATGTGAGTATGG + Exonic
1032931381 7:136676607-136676629 AAAAATAATGTATGTTGGCATGG - Intergenic
1033157806 7:138971566-138971588 AAGGGTGCTGTGTGTGTGCAAGG - Intronic
1033369958 7:140698522-140698544 AGGGATATTGTATTTGGGGATGG + Intronic
1038519405 8:28216979-28217001 AAGGATACCATAAGTGGGCCAGG + Intergenic
1039076317 8:33693406-33693428 AATGATACAGGAGGTGGGCAGGG - Intergenic
1043734099 8:83723340-83723362 AAGGAGTCTGTAAGTGAGCATGG + Intergenic
1045677244 8:104620786-104620808 AAGGATTGTGAATGTGGGTAAGG + Intronic
1045902238 8:107296247-107296269 CAGGAAACTTTAGGTGGGCAGGG + Intronic
1046651805 8:116843781-116843803 GAGGATACTGCCTATGGGCATGG + Intronic
1051437178 9:17045115-17045137 AGGGATCCTGTATCTGGGGAAGG + Intergenic
1053032953 9:34797879-34797901 AATGATACTGAATGTGGGAAGGG - Intergenic
1056812637 9:89776391-89776413 ATGGCTGCTGTCTGTGGGCAGGG - Intergenic
1058052259 9:100418826-100418848 AAGGAAACTGAATATGGACAAGG + Intergenic
1061884174 9:133583316-133583338 ATGGAGACTGTAGGTGGCCATGG + Intronic
1186174769 X:6914345-6914367 CATGATTCTGTATGTGGACAAGG - Intergenic
1191071318 X:56403290-56403312 AAGCTTACAGTATGTGTGCACGG + Intergenic
1191586450 X:62832477-62832499 AAAGATACTATCTGTTGGCAAGG + Intergenic
1192204393 X:69086464-69086486 AAGGCTCCTGTCTGTGGCCACGG - Intergenic
1192373428 X:70534932-70534954 AAGGATATTGGCTGGGGGCAGGG - Intronic
1192512931 X:71736207-71736229 TAGGACACAGTATGTGGGAAGGG - Intergenic
1192513766 X:71745302-71745324 TAGGACACAGTATGTGGGAAGGG + Intergenic
1194211355 X:91072797-91072819 AATGATACTGCATGGGGGAAGGG - Intergenic
1196903933 X:120413341-120413363 AGGGTTTCTGTGTGTGGGCAGGG - Intergenic
1197755043 X:129987508-129987530 AAGGATACTGAATGGGGGGAGGG + Intronic
1200714650 Y:6524380-6524402 AAGAATGATGTATGTGGGCAAGG - Intergenic
1201019174 Y:9636750-9636772 AAGAATGATGTATGTGGGCAAGG + Intergenic
1202110813 Y:21417416-21417438 AAGAATAATATATGCGGGCAAGG + Intergenic