ID: 1030138729 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 7:106284643-106284665 |
| Sequence | AGGTGAGGAGGCGCCGCAGT GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 164 | |||
| Summary | {0: 1, 1: 0, 2: 0, 3: 14, 4: 149} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1030138729_1030138740 | 10 | Left | 1030138729 | 7:106284643-106284665 | CCCACTGCGGCGCCTCCTCACCT | 0: 1 1: 0 2: 0 3: 14 4: 149 |
||
| Right | 1030138740 | 7:106284676-106284698 | CCGCCGCCCGCGCCTCCCCCGGG | 0: 1 1: 1 2: 14 3: 123 4: 850 |
||||
| 1030138729_1030138738 | 9 | Left | 1030138729 | 7:106284643-106284665 | CCCACTGCGGCGCCTCCTCACCT | 0: 1 1: 0 2: 0 3: 14 4: 149 |
||
| Right | 1030138738 | 7:106284675-106284697 | GCCGCCGCCCGCGCCTCCCCCGG | 0: 2 1: 1 2: 10 3: 140 4: 753 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1030138729 | Original CRISPR | AGGTGAGGAGGCGCCGCAGT GGG (reversed) | Intronic | ||