ID: 1030138729

View in Genome Browser
Species Human (GRCh38)
Location 7:106284643-106284665
Sequence AGGTGAGGAGGCGCCGCAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 149}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030138729_1030138740 10 Left 1030138729 7:106284643-106284665 CCCACTGCGGCGCCTCCTCACCT 0: 1
1: 0
2: 0
3: 14
4: 149
Right 1030138740 7:106284676-106284698 CCGCCGCCCGCGCCTCCCCCGGG 0: 1
1: 1
2: 14
3: 123
4: 850
1030138729_1030138738 9 Left 1030138729 7:106284643-106284665 CCCACTGCGGCGCCTCCTCACCT 0: 1
1: 0
2: 0
3: 14
4: 149
Right 1030138738 7:106284675-106284697 GCCGCCGCCCGCGCCTCCCCCGG 0: 2
1: 1
2: 10
3: 140
4: 753

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030138729 Original CRISPR AGGTGAGGAGGCGCCGCAGT GGG (reversed) Intronic