ID: 1030141108

View in Genome Browser
Species Human (GRCh38)
Location 7:106304747-106304769
Sequence TCCAGGAAGTTCAAGGGGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030141108_1030141117 5 Left 1030141108 7:106304747-106304769 CCCAACCCCTTGAACTTCCTGGA No data
Right 1030141117 7:106304775-106304797 TGATGCCCCACCCTGTTTTGGGG No data
1030141108_1030141116 4 Left 1030141108 7:106304747-106304769 CCCAACCCCTTGAACTTCCTGGA No data
Right 1030141116 7:106304774-106304796 GTGATGCCCCACCCTGTTTTGGG No data
1030141108_1030141115 3 Left 1030141108 7:106304747-106304769 CCCAACCCCTTGAACTTCCTGGA No data
Right 1030141115 7:106304773-106304795 GGTGATGCCCCACCCTGTTTTGG 0: 5
1: 88
2: 256
3: 655
4: 1331

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030141108 Original CRISPR TCCAGGAAGTTCAAGGGGTT GGG (reversed) Intergenic
No off target data available for this crispr