ID: 1030142673

View in Genome Browser
Species Human (GRCh38)
Location 7:106320910-106320932
Sequence CCCGGCCACCTGGCCATATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030142673_1030142679 5 Left 1030142673 7:106320910-106320932 CCTCATATGGCCAGGTGGCCGGG No data
Right 1030142679 7:106320938-106320960 CTCTGAGATGAAGCTTCCAGAGG 0: 315
1: 1107
2: 1390
3: 3120
4: 1742
1030142673_1030142681 15 Left 1030142673 7:106320910-106320932 CCTCATATGGCCAGGTGGCCGGG No data
Right 1030142681 7:106320948-106320970 AAGCTTCCAGAGGAAGGATCAGG 0: 978
1: 1673
2: 2104
3: 1348
4: 926
1030142673_1030142680 9 Left 1030142673 7:106320910-106320932 CCTCATATGGCCAGGTGGCCGGG No data
Right 1030142680 7:106320942-106320964 GAGATGAAGCTTCCAGAGGAAGG 0: 193
1: 822
2: 1094
3: 1118
4: 1104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030142673 Original CRISPR CCCGGCCACCTGGCCATATG AGG (reversed) Intergenic
No off target data available for this crispr