ID: 1030156442

View in Genome Browser
Species Human (GRCh38)
Location 7:106460380-106460402
Sequence GTTTCTCCCAAGACAGAGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030156442_1030156446 -3 Left 1030156442 7:106460380-106460402 CCCCACTCTGTCTTGGGAGAAAC No data
Right 1030156446 7:106460400-106460422 AACTCTAACTCCCCTAAGCTGGG No data
1030156442_1030156445 -4 Left 1030156442 7:106460380-106460402 CCCCACTCTGTCTTGGGAGAAAC No data
Right 1030156445 7:106460399-106460421 AAACTCTAACTCCCCTAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030156442 Original CRISPR GTTTCTCCCAAGACAGAGTG GGG (reversed) Intergenic
No off target data available for this crispr