ID: 1030161324

View in Genome Browser
Species Human (GRCh38)
Location 7:106511257-106511279
Sequence CAGCATGAAGAGAGGAAGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030161321_1030161324 -2 Left 1030161321 7:106511236-106511258 CCTTGTTGCCTGTGCTCAGCACA No data
Right 1030161324 7:106511257-106511279 CAGCATGAAGAGAGGAAGCATGG No data
1030161320_1030161324 20 Left 1030161320 7:106511214-106511236 CCTTCTCTATAGGATTAGCTTTC No data
Right 1030161324 7:106511257-106511279 CAGCATGAAGAGAGGAAGCATGG No data
1030161322_1030161324 -10 Left 1030161322 7:106511244-106511266 CCTGTGCTCAGCACAGCATGAAG No data
Right 1030161324 7:106511257-106511279 CAGCATGAAGAGAGGAAGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030161324 Original CRISPR CAGCATGAAGAGAGGAAGCA TGG Intergenic
No off target data available for this crispr