ID: 1030164066

View in Genome Browser
Species Human (GRCh38)
Location 7:106535323-106535345
Sequence GTGTGGTAAGGCTGGATCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030164059_1030164066 0 Left 1030164059 7:106535300-106535322 CCCGTTTCATGCTTCTTCCCTTT No data
Right 1030164066 7:106535323-106535345 GTGTGGTAAGGCTGGATCCCTGG No data
1030164060_1030164066 -1 Left 1030164060 7:106535301-106535323 CCGTTTCATGCTTCTTCCCTTTG No data
Right 1030164066 7:106535323-106535345 GTGTGGTAAGGCTGGATCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030164066 Original CRISPR GTGTGGTAAGGCTGGATCCC TGG Intergenic
No off target data available for this crispr