ID: 1030166641

View in Genome Browser
Species Human (GRCh38)
Location 7:106562191-106562213
Sequence CTGTGTAAGTCCCAGTCTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030166641_1030166643 -10 Left 1030166641 7:106562191-106562213 CCCTCAGACTGGGACTTACACAG No data
Right 1030166643 7:106562204-106562226 ACTTACACAGTCAGCATTTCTGG No data
1030166641_1030166645 5 Left 1030166641 7:106562191-106562213 CCCTCAGACTGGGACTTACACAG No data
Right 1030166645 7:106562219-106562241 ATTTCTGGTTCCCAGGCCTTCGG No data
1030166641_1030166648 16 Left 1030166641 7:106562191-106562213 CCCTCAGACTGGGACTTACACAG No data
Right 1030166648 7:106562230-106562252 CCAGGCCTTCGGACTCAGACTGG No data
1030166641_1030166644 -2 Left 1030166641 7:106562191-106562213 CCCTCAGACTGGGACTTACACAG No data
Right 1030166644 7:106562212-106562234 AGTCAGCATTTCTGGTTCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030166641 Original CRISPR CTGTGTAAGTCCCAGTCTGA GGG (reversed) Intergenic
No off target data available for this crispr