ID: 1030171198

View in Genome Browser
Species Human (GRCh38)
Location 7:106604559-106604581
Sequence CAGTATTGGAATCTTGTAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030171195_1030171198 0 Left 1030171195 7:106604536-106604558 CCAATGCATTAAAAAGTTCCTTT No data
Right 1030171198 7:106604559-106604581 CAGTATTGGAATCTTGTAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030171198 Original CRISPR CAGTATTGGAATCTTGTAGA AGG Intergenic
No off target data available for this crispr