ID: 1030173262

View in Genome Browser
Species Human (GRCh38)
Location 7:106626106-106626128
Sequence TCTCCTACATGTATTCCTCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030173262_1030173266 17 Left 1030173262 7:106626106-106626128 CCGTGAGGAATACATGTAGGAGA No data
Right 1030173266 7:106626146-106626168 AATCATTTATCAAATTCTAGGGG No data
1030173262_1030173264 15 Left 1030173262 7:106626106-106626128 CCGTGAGGAATACATGTAGGAGA No data
Right 1030173264 7:106626144-106626166 TAAATCATTTATCAAATTCTAGG No data
1030173262_1030173265 16 Left 1030173262 7:106626106-106626128 CCGTGAGGAATACATGTAGGAGA No data
Right 1030173265 7:106626145-106626167 AAATCATTTATCAAATTCTAGGG No data
1030173262_1030173267 18 Left 1030173262 7:106626106-106626128 CCGTGAGGAATACATGTAGGAGA No data
Right 1030173267 7:106626147-106626169 ATCATTTATCAAATTCTAGGGGG No data
1030173262_1030173263 -8 Left 1030173262 7:106626106-106626128 CCGTGAGGAATACATGTAGGAGA No data
Right 1030173263 7:106626121-106626143 GTAGGAGACACTATTTGAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030173262 Original CRISPR TCTCCTACATGTATTCCTCA CGG (reversed) Intergenic