ID: 1030176852

View in Genome Browser
Species Human (GRCh38)
Location 7:106662573-106662595
Sequence ATGCATAAGTAGAATGACGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030176851_1030176852 10 Left 1030176851 7:106662540-106662562 CCAGACTCTAAGGAATTCAATAG No data
Right 1030176852 7:106662573-106662595 ATGCATAAGTAGAATGACGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030176852 Original CRISPR ATGCATAAGTAGAATGACGA AGG Intergenic
No off target data available for this crispr