ID: 1030177110

View in Genome Browser
Species Human (GRCh38)
Location 7:106665948-106665970
Sequence GAGGAGAAAAAATATGAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030177106_1030177110 27 Left 1030177106 7:106665898-106665920 CCTCTGGGACTATAAGATCTAAT No data
Right 1030177110 7:106665948-106665970 GAGGAGAAAAAATATGAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030177110 Original CRISPR GAGGAGAAAAAATATGAGGC TGG Intergenic
No off target data available for this crispr