ID: 1030184762

View in Genome Browser
Species Human (GRCh38)
Location 7:106750739-106750761
Sequence TTGCAGAAGCAGCAGAAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030184762_1030184767 -6 Left 1030184762 7:106750739-106750761 CCCTCCTTCTGCTGCTTCTGCAA No data
Right 1030184767 7:106750756-106750778 CTGCAACCCTCCTGGAGGAATGG No data
1030184762_1030184774 6 Left 1030184762 7:106750739-106750761 CCCTCCTTCTGCTGCTTCTGCAA No data
Right 1030184774 7:106750768-106750790 TGGAGGAATGGGGGAAATGTAGG No data
1030184762_1030184775 24 Left 1030184762 7:106750739-106750761 CCCTCCTTCTGCTGCTTCTGCAA No data
Right 1030184775 7:106750786-106750808 GTAGGAAGTCTTCCGCCCTTTGG No data
1030184762_1030184768 -5 Left 1030184762 7:106750739-106750761 CCCTCCTTCTGCTGCTTCTGCAA No data
Right 1030184768 7:106750757-106750779 TGCAACCCTCCTGGAGGAATGGG No data
1030184762_1030184776 25 Left 1030184762 7:106750739-106750761 CCCTCCTTCTGCTGCTTCTGCAA No data
Right 1030184776 7:106750787-106750809 TAGGAAGTCTTCCGCCCTTTGGG No data
1030184762_1030184770 -3 Left 1030184762 7:106750739-106750761 CCCTCCTTCTGCTGCTTCTGCAA No data
Right 1030184770 7:106750759-106750781 CAACCCTCCTGGAGGAATGGGGG No data
1030184762_1030184769 -4 Left 1030184762 7:106750739-106750761 CCCTCCTTCTGCTGCTTCTGCAA No data
Right 1030184769 7:106750758-106750780 GCAACCCTCCTGGAGGAATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030184762 Original CRISPR TTGCAGAAGCAGCAGAAGGA GGG (reversed) Intergenic
No off target data available for this crispr