ID: 1030185799

View in Genome Browser
Species Human (GRCh38)
Location 7:106760475-106760497
Sequence CATGGAGAGCAGGCCCGAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030185799_1030185802 -7 Left 1030185799 7:106760475-106760497 CCTTTTCGGGCCTGCTCTCCATG No data
Right 1030185802 7:106760491-106760513 CTCCATGTGACCAAGGAGAGTGG No data
1030185799_1030185806 17 Left 1030185799 7:106760475-106760497 CCTTTTCGGGCCTGCTCTCCATG No data
Right 1030185806 7:106760515-106760537 CTAGAGAAGAAAATCAAGCCAGG No data
1030185799_1030185807 18 Left 1030185799 7:106760475-106760497 CCTTTTCGGGCCTGCTCTCCATG No data
Right 1030185807 7:106760516-106760538 TAGAGAAGAAAATCAAGCCAGGG No data
1030185799_1030185803 -6 Left 1030185799 7:106760475-106760497 CCTTTTCGGGCCTGCTCTCCATG No data
Right 1030185803 7:106760492-106760514 TCCATGTGACCAAGGAGAGTGGG No data
1030185799_1030185808 19 Left 1030185799 7:106760475-106760497 CCTTTTCGGGCCTGCTCTCCATG No data
Right 1030185808 7:106760517-106760539 AGAGAAGAAAATCAAGCCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030185799 Original CRISPR CATGGAGAGCAGGCCCGAAA AGG (reversed) Intergenic
No off target data available for this crispr