ID: 1030188030

View in Genome Browser
Species Human (GRCh38)
Location 7:106782256-106782278
Sequence CTGACAGGATAGAAGAAAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 595
Summary {0: 1, 1: 1, 2: 3, 3: 49, 4: 541}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030188030 Original CRISPR CTGACAGGATAGAAGAAAAA GGG (reversed) Intergenic
900350640 1:2232925-2232947 CCGACCGGAAAGAAGAAAGAGGG - Intronic
905278305 1:36833333-36833355 CTGACAGGTCAGAAGGAAGAGGG - Intronic
906273713 1:44500937-44500959 CTGACAGGACAGAAGAGCCAAGG - Intronic
906334859 1:44920145-44920167 GACACAGGATATAAGAAAAAGGG - Intronic
906730827 1:48079708-48079730 CTGAAAGGATAGCAGGAGAAAGG - Intergenic
907951020 1:59184306-59184328 CTGCAAGGAAAGATGAAAAATGG - Intergenic
908295273 1:62706829-62706851 CTGTCAGGAAAAAAAAAAAAAGG - Intergenic
908475588 1:64484415-64484437 CTGACAGCATACAAGCAGAAGGG + Intronic
908696690 1:66850511-66850533 CTGAAAGGAAAAAAGAACAATGG + Intronic
908954054 1:69599707-69599729 CTGCCAGCAAGGAAGAAAAAGGG - Intronic
909224205 1:72995743-72995765 CTCACAGGATAGAAATATAAAGG - Intergenic
909351807 1:74662331-74662353 CTGAAAGGAAAGAAGAACTATGG + Intronic
909554861 1:76942198-76942220 GTTACAGGTTAGAAGACAAAAGG - Intronic
910441731 1:87260090-87260112 ATGACAGGATGGAAGAAATTTGG + Intergenic
910756914 1:90703947-90703969 CTGTAAGGATAGGAGACAAAAGG - Intergenic
910756918 1:90703963-90703985 CTTACAGGAAAAAATAAAAATGG + Intergenic
910811030 1:91236812-91236834 TTGACAGGTTAGAGGAAGAAAGG - Intergenic
911468282 1:98282530-98282552 CTGAGAGGATAAAACATAAAAGG - Intergenic
911687281 1:100792026-100792048 CTCACAGGGTAGAAGAATCAAGG + Intergenic
912478007 1:109953977-109953999 GTTACATTATAGAAGAAAAATGG + Intergenic
912478008 1:109953996-109954018 ATGGCATTATAGAAGAAAAATGG + Intergenic
912970013 1:114272314-114272336 CTCACAGAAAAGAAAAAAAATGG + Intergenic
912987401 1:114448120-114448142 CTGACAGGTTAGCAGAAAGAAGG + Intronic
913188678 1:116394221-116394243 CTGTCAGGGTAGAAAAAAATAGG - Intronic
913481984 1:119297169-119297191 ATTACAGGATAGAATAAAATAGG - Intergenic
914352082 1:146849050-146849072 CAGACAGGCTAAATGAAAAAGGG - Intergenic
914741846 1:150472172-150472194 CTGATAGCACAGAAGAAAAGGGG + Exonic
915805371 1:158843256-158843278 CTGACAAAAGAAAAGAAAAAGGG - Intronic
916152916 1:161813565-161813587 AGGACAGAATAAAAGAAAAAGGG - Intronic
916417343 1:164604574-164604596 CTCTCAGGACAGAATAAAAAAGG - Intronic
917584162 1:176408488-176408510 TAGACAGGAGAGAAGAAAGAGGG - Intergenic
917727308 1:177839931-177839953 CTGTGAGGATAGAAGCATAATGG - Intergenic
918323396 1:183385976-183385998 CTGACAGCATAGAAGGGAACTGG + Intronic
918952434 1:191156280-191156302 CTTACAGGATGGAAGAAAGGGGG + Intergenic
919179732 1:194064912-194064934 ATGATAGGAAAGAAGTAAAATGG - Intergenic
919367525 1:196682664-196682686 GTGACAGAAAAAAAGAAAAAAGG + Intronic
919827771 1:201515918-201515940 CTTAAAGGTTAGAAGCAAAATGG + Intergenic
920003191 1:202813101-202813123 CTGCCAGGAAAGAGGAAAAAGGG - Intergenic
920494233 1:206442882-206442904 CTCACAGCAATGAAGAAAAAGGG - Intronic
922309952 1:224379046-224379068 CTGAAAGGATAGAAGGAAAAAGG - Exonic
923276001 1:232396923-232396945 CTGATGGGAAAGAAAAAAAAGGG + Intergenic
923836791 1:237619530-237619552 CTCAGAGGATAGGAGAAAGAGGG + Intronic
923876405 1:238053923-238053945 CTGTGAGGCTAGAAGCAAAATGG - Intergenic
923955560 1:239014664-239014686 CTAACAGCTTAGAAGAAGAATGG + Intergenic
924006504 1:239617936-239617958 CTGCCAGGAAACAATAAAAAAGG - Intronic
1062865769 10:852092-852114 AAGAAAGGAAAGAAGAAAAAAGG + Intronic
1063010094 10:2012993-2013015 CTGATAGGCTCGAAGTAAAATGG + Intergenic
1063357520 10:5414733-5414755 CAGACAGTAGAGGAGAAAAATGG + Intronic
1063899988 10:10722531-10722553 TTGAGAGGAGAAAAGAAAAAGGG - Intergenic
1064987370 10:21224987-21225009 CAGACAAGAGAGAAAAAAAAAGG - Intergenic
1065980381 10:30889009-30889031 CTGACAAGGTTGAAGAGAAAAGG - Intronic
1066096315 10:32075918-32075940 CTGTCAGGATACATGATAAAGGG - Intergenic
1067034873 10:42906719-42906741 CAGACAAGAGAGAAGAATAAAGG + Intergenic
1067283150 10:44888200-44888222 CTGGCAGCATTGAAGATAAATGG + Intergenic
1068082031 10:52330977-52330999 CAGACAAGATAGCAGAAATACGG + Intergenic
1068332163 10:55585104-55585126 TTTACAGGAAGGAAGAAAAAAGG - Intronic
1068613460 10:59086269-59086291 CTTACAGGAGAGAAGAAAACGGG + Intergenic
1068814915 10:61298273-61298295 CAGCAAGGAGAGAAGAAAAAAGG + Intergenic
1068964893 10:62902072-62902094 CTGACAAGACAAAGGAAAAAGGG - Intronic
1070502770 10:77087113-77087135 CCGGCAGGAAAGAAGCAAAAGGG - Intronic
1070701626 10:78606174-78606196 CTTACAGCATAAAAAAAAAATGG - Intergenic
1070859011 10:79634341-79634363 CTGACTTAATAGAAGAAAAAAGG + Intergenic
1071876550 10:89849337-89849359 ATGACAGAAAAGAAGACAAAGGG + Intergenic
1072439892 10:95445056-95445078 CTGAGAGGGTAGAAGGAGAATGG + Intronic
1073579163 10:104648350-104648372 CTGAGAAGAAAGGAGAAAAATGG - Intronic
1074728968 10:116348268-116348290 CTGACAGGTAAGAAGACAAATGG - Intronic
1074929370 10:118108102-118108124 CTGAAATGATAGGAGAAATATGG + Intergenic
1075757793 10:124828673-124828695 CTGACAGTCTAAAAAAAAAAAGG - Intronic
1075837561 10:125468286-125468308 GTGCCAGGATGGAAGAATAACGG + Intergenic
1075883966 10:125880810-125880832 CAGACAAGATGGAAGAAGAAGGG - Exonic
1075885709 10:125897037-125897059 CTGACATTTTAGAAGAAAAATGG - Intronic
1076240754 10:128904713-128904735 CAGACAGGATATGAGAAAAGAGG + Intergenic
1077596434 11:3536025-3536047 CTTACAGGCTAGGAGAAAAGGGG + Intergenic
1078151088 11:8760194-8760216 CTGAGAAGATAGAAGGAAAGGGG - Intronic
1078470887 11:11585728-11585750 CTGGTTTGATAGAAGAAAAATGG - Intronic
1079245693 11:18750680-18750702 CTGGCAGGATAGGAGGATAAGGG - Intronic
1079761640 11:24336276-24336298 ATGACAGGATAGAGGAAGACAGG - Intergenic
1079999606 11:27332783-27332805 CTAACAGGATTCTAGAAAAAAGG + Intronic
1080205634 11:29725767-29725789 CTGAAAGGAAAGAAGACCAAGGG + Intergenic
1080307414 11:30851541-30851563 TAGAGAGGATACAAGAAAAATGG - Intronic
1080489545 11:32748204-32748226 AAGACAGGAAGGAAGAAAAAAGG - Intronic
1080674951 11:34417309-34417331 ATAAAAGGATAGAAGATAAAAGG - Intergenic
1080809788 11:35692143-35692165 CTGCAAGGATAAAAAAAAAATGG - Intronic
1080913686 11:36631959-36631981 TTTAGAGAATAGAAGAAAAAAGG - Intronic
1081276016 11:41149642-41149664 CAGATAGGATAGATGAAGAAGGG + Intronic
1082213949 11:49544236-49544258 CTGAAAGGACATAAGAAAACAGG + Intergenic
1085038588 11:73313898-73313920 GTAGCAGGAAAGAAGAAAAATGG + Intronic
1086572764 11:88304432-88304454 CTTATAGGATGGTAGAAAAAAGG - Intronic
1086635652 11:89080253-89080275 CTGAAAGGACATAAGAAAACAGG - Intergenic
1086720778 11:90118519-90118541 TTGACAGGATATAACACAAAAGG + Intergenic
1086762361 11:90648269-90648291 CAGACAATATAGAAGAAATAAGG + Intergenic
1086880798 11:92151436-92151458 CCTTCAGGATAGAAGAGAAATGG - Intergenic
1086899084 11:92346067-92346089 CTGCCTGAAAAGAAGAAAAAGGG - Intergenic
1087095045 11:94309927-94309949 CTGACAGTTTAAAAGTAAAAAGG + Intergenic
1087209121 11:95428269-95428291 CTGTGAGGGAAGAAGAAAAATGG - Intergenic
1087307883 11:96505847-96505869 CTGACAGGGCAGAAGGATAAAGG - Intronic
1087439145 11:98160816-98160838 CTGATAAGATAGAAGAGAGAAGG - Intergenic
1087995044 11:104795490-104795512 CAGACAGGAGAGGAGATAAAGGG + Intergenic
1088101653 11:106162476-106162498 CTGTGAGGCTAGAAGCAAAATGG + Intergenic
1088175094 11:107044695-107044717 CTGACAGGAAAGTAGAATCAAGG + Intergenic
1088265059 11:107980811-107980833 TGGACAGGAATGAAGAAAAAGGG - Intergenic
1088320793 11:108552893-108552915 GTGAAAGAAAAGAAGAAAAAAGG + Intronic
1088649148 11:111942113-111942135 CAGGCAGGATAGAAAAAAGAAGG - Intronic
1089944926 11:122460958-122460980 CACAAAGGACAGAAGAAAAATGG + Intergenic
1091077793 11:132637259-132637281 CTGCCAGGATTGGAAAAAAACGG - Intronic
1091099233 11:132854876-132854898 CTGTGAGGCTAGAAGAAAGATGG - Intronic
1091515015 12:1170616-1170638 CTGACTAGATAGAAAAAGAAGGG + Intronic
1092518878 12:9245469-9245491 CTGACAGAATAGAAGAAAAATGG - Intergenic
1092527764 12:9319636-9319658 CTGACAGGAGGGAAGAGAAGTGG - Intergenic
1092727271 12:11498546-11498568 CTGACAGGAGGGAAGAGAAGTGG + Intronic
1092993872 12:13929616-13929638 GTGACAGGATAGAGGAAAGCTGG - Intronic
1093354907 12:18155015-18155037 CTTAAAGGTTAGAAGAAAGATGG - Intronic
1094167543 12:27458006-27458028 CTGACAGCAGATGAGAAAAATGG - Intergenic
1094500012 12:31012683-31012705 CTGACAGGATAGAAGAGAAGTGG - Intergenic
1094763535 12:33563032-33563054 ATTACAGGCTAGAAGAAAAGGGG + Intergenic
1096172137 12:49480025-49480047 CTGACAAGCAAGGAGAAAAATGG - Intronic
1096589142 12:52645695-52645717 CTGGCAGCATAGAAGAAAGTGGG - Intronic
1096748330 12:53743151-53743173 AAGACAGGAAAGAAGAAAGAAGG - Intergenic
1097681359 12:62652569-62652591 CTGACAGAAAACAAGAAAGAAGG - Intronic
1098137602 12:67419238-67419260 CTAAAAGGGTAGAGGAAAAAGGG - Intergenic
1098576189 12:72045794-72045816 TTGCAAGGAGAGAAGAAAAAGGG - Intronic
1099942643 12:89207101-89207123 AGGAGAGGAGAGAAGAAAAATGG - Intergenic
1101493192 12:105229224-105229246 CTGGAAGAAAAGAAGAAAAAAGG + Intronic
1103280457 12:119753813-119753835 ATGACAGAATAGGAGAGAAAGGG + Intronic
1104838255 12:131806561-131806583 CTCACAGAATGGAAGGAAAACGG + Intergenic
1106201041 13:27537591-27537613 GTTACAGGACAGAGGAAAAAAGG + Intergenic
1106287780 13:28332769-28332791 TTGAGAGGAAATAAGAAAAATGG + Intronic
1107718390 13:43222941-43222963 ATGACAGGGTAGAACAAAACAGG - Intronic
1108807674 13:54179941-54179963 CTGAAAGGAGAGAAAAGAAATGG + Intergenic
1109288322 13:60439069-60439091 TGGACTGGATAAAAGAAAAAAGG + Intronic
1110530221 13:76588915-76588937 GGGACAGTAGAGAAGAAAAAGGG + Intergenic
1110685062 13:78362787-78362809 CTCACACGATAGAAGAAATGAGG + Intergenic
1110688670 13:78405439-78405461 ATCACAGGAGAGAAGTAAAAAGG + Intergenic
1111160323 13:84385400-84385422 AGGACAGAATAGAAAAAAAAAGG + Intergenic
1111196868 13:84886902-84886924 CTGATAGAAGACAAGAAAAAGGG + Intergenic
1111536581 13:89609499-89609521 ATGACAGGGAAGAAGTAAAAAGG - Intergenic
1111549428 13:89787070-89787092 CTCACACGGTAGAAGAGAAAAGG + Intergenic
1112202401 13:97289980-97290002 CCAACAGGATAGATGAAATAAGG + Intronic
1112313154 13:98337644-98337666 CTGACAGAACTCAAGAAAAAAGG - Intronic
1112592489 13:100776431-100776453 CTTAAAGGTTAGAAGCAAAATGG - Intergenic
1112791170 13:103003612-103003634 CTGAGAAGACAGAACAAAAATGG + Intergenic
1112824268 13:103373903-103373925 ATGACAGGATTGAAAACAAAGGG - Intergenic
1113907255 13:113825531-113825553 CTGTCCGGATAGACCAAAAAGGG + Intronic
1114303346 14:21397945-21397967 CTCATAGCCTAGAAGAAAAAGGG + Exonic
1114533928 14:23411539-23411561 GTGACAGCAGAGGAGAAAAAGGG - Intergenic
1115447015 14:33502302-33502324 CTGGGAGGAGAGAAGAAAAGGGG - Intronic
1115754461 14:36518473-36518495 CTGACAGGAGAGAAGCCAAGAGG - Intronic
1115860320 14:37678896-37678918 CTAAAAGGCTAGAAGAAAAAGGG + Intronic
1115900927 14:38147434-38147456 TTTACAGGAAAAAAGAAAAATGG + Intergenic
1116054486 14:39846359-39846381 TTGACAGCATCTAAGAAAAAGGG + Intergenic
1116060035 14:39911875-39911897 CTGAGAGGAGAGAAGAGAGAGGG - Intergenic
1116637114 14:47411221-47411243 CACACTGGATAGAAAAAAAAAGG - Intronic
1116884350 14:50204986-50205008 CTGACTGGATATAAGAAATATGG + Intronic
1117178637 14:53170411-53170433 CTGGCAGAATAGAGAAAAAAAGG - Intergenic
1118442759 14:65827153-65827175 CTCACAGGAAAGAAGAATAGAGG + Intergenic
1118730801 14:68664974-68664996 CTGAAAGGACAGAAGGAACATGG - Intronic
1118941576 14:70344413-70344435 CTTACAGGTTAGAAGCAAGATGG + Intronic
1119705974 14:76782777-76782799 CTGACAAGAGAGAAGAAACATGG + Exonic
1120162553 14:81161454-81161476 CTGAAAGGACAGAAAAAACAGGG - Intergenic
1120626523 14:86833318-86833340 CTCACAGGATAGGAGAGAATAGG + Intergenic
1122147480 14:99700214-99700236 CTGAAGGGAGAGAGGAAAAAGGG + Intronic
1202872364 14_GL000225v1_random:176904-176926 CTGGCATTTTAGAAGAAAAATGG + Intergenic
1123820144 15:24021185-24021207 CTGACGAGATACAACAAAAAGGG + Intergenic
1123955957 15:25334938-25334960 CTGACAAGATAACAGAAAGATGG + Intronic
1124091118 15:26601827-26601849 AAGACAGGAAAGAAGAAAGAAGG + Intronic
1124353380 15:28977058-28977080 CTCACAAGAAAGAAGAAAAATGG - Intronic
1124864645 15:33477344-33477366 GTGAGAGGATAGAAGAATAAAGG + Intronic
1125012668 15:34897416-34897438 CTGACAGAATAGAAAGAAAGAGG + Intronic
1125105873 15:35970343-35970365 CTGGAAGGATAGAAAACAAAAGG - Intergenic
1125604669 15:40933075-40933097 CTAGCAGGATGCAAGAAAAAAGG - Intronic
1125607788 15:40951908-40951930 GGGACAGGATAGAAGAGAAGAGG + Intergenic
1126738834 15:51757713-51757735 CTAACAGGACGGAAGACAAATGG + Intronic
1127678122 15:61263796-61263818 GTGACAGAAGAGAAGAAAAAGGG + Intergenic
1128316891 15:66666095-66666117 CTGACAAAATAAAAGAAACAAGG + Intronic
1128996804 15:72303286-72303308 CTGACTGGAAAGAATAAAAAGGG + Intronic
1129981634 15:79877108-79877130 TTGAGATGATGGAAGAAAAAAGG + Intronic
1131223473 15:90604857-90604879 TTGTCAGGATTGAAAAAAAATGG - Intronic
1131241651 15:90749063-90749085 GTGACAGCATAAATGAAAAAGGG - Intronic
1131769575 15:95720917-95720939 ATAACAGGAAAGAAGAAACAGGG - Intergenic
1132234578 15:100209566-100209588 CTGACAGGATATAAAAATGACGG + Intronic
1133158099 16:3889942-3889964 CAGACAGGAAAGAAGGAAGAAGG - Intergenic
1133443593 16:5840926-5840948 CTAAGAGCTTAGAAGAAAAAAGG - Intergenic
1134360953 16:13530690-13530712 CTGTAAGGAAGGAAGAAAAAGGG - Intergenic
1134671032 16:16055250-16055272 CTGACAAGAAATAAGAAAACAGG + Intronic
1135479249 16:22808214-22808236 CTGAGAAGAAAAAAGAAAAAAGG - Intergenic
1136687107 16:32002095-32002117 CTGACTGCAGAGAAGACAAAAGG - Intergenic
1136787719 16:32945646-32945668 CTGACTGCAGAGAAGACAAAAGG - Intergenic
1136882062 16:33908143-33908165 CTGACTGCAGAGAAGACAAAAGG + Intergenic
1137043871 16:35638835-35638857 CTGAGAAGACATAAGAAAAATGG + Intergenic
1137453191 16:48596628-48596650 CTGAAAGGTTAGAAGCAAGATGG - Intronic
1137957846 16:52851128-52851150 CTTACAGGCCAGAAGAAAATGGG - Intergenic
1138316680 16:56076294-56076316 CTTACAAGAACGAAGAAAAATGG - Intergenic
1139011502 16:62640184-62640206 CTGACAGGATCTAGGAGAAAGGG + Intergenic
1139981949 16:70866482-70866504 CAGACAGGCTAAATGAAAAAGGG + Intronic
1140718081 16:77744963-77744985 ATGACAGGATACAAAAGAAAAGG - Intergenic
1141024721 16:80535203-80535225 CTGACTGGGTAGAATAAACATGG - Intergenic
1203089948 16_KI270728v1_random:1207303-1207325 CTGACTGCAGAGAAGACAAAAGG - Intergenic
1143232457 17:5368514-5368536 ATGTCAAGATAGAACAAAAAAGG - Intronic
1143985776 17:10912504-10912526 CTGTGAGGCTAGAAGCAAAATGG + Intergenic
1145052652 17:19675539-19675561 CTGCCTGGAGAGAGGAAAAAAGG - Exonic
1146534481 17:33638379-33638401 CTGTGAGGATAGAAGCAAGATGG + Intronic
1146535036 17:33642604-33642626 CTGACAGGATAGAAGGTTGATGG - Intronic
1147148074 17:38497766-38497788 CTGACTGCAGAGAAGACAAAAGG - Exonic
1147813983 17:43195180-43195202 AGGACAGGAAAGAAGAAAAACGG - Intronic
1147950047 17:44102361-44102383 CTGTCAGAAAAAAAGAAAAAGGG - Intronic
1148843919 17:50517572-50517594 CTGGGAGGATAAAAGAAGAAAGG - Intronic
1150024873 17:61663530-61663552 CTTACAGGATAAAAGAAACTGGG - Intergenic
1150206011 17:63408182-63408204 CTTTCAGCATAGAACAAAAAAGG + Intronic
1150290163 17:63976544-63976566 CTAACAGGATAGAGGAAGACGGG - Intergenic
1150550706 17:66207227-66207249 CTGAGAGGTGAGAAGAAAGATGG + Intergenic
1150986424 17:70202868-70202890 TTGACAGAAGGGAAGAAAAAAGG + Intergenic
1151234533 17:72709714-72709736 CTGAAAGGATACAGGAAATAGGG - Intronic
1151620166 17:75240413-75240435 CTGACAATAGAGAAGAAAACAGG + Intronic
1153282207 18:3425229-3425251 CTGTGAGGATAGAAGCAAGATGG - Intronic
1153345436 18:4020617-4020639 CTGAGAGGTTAGAAGCAAGATGG - Intronic
1153372276 18:4332798-4332820 CTGAGAGGTCAGAAGGAAAATGG - Intronic
1153574099 18:6503882-6503904 TTGAAAGGAAGGAAGAAAAAGGG + Intergenic
1153779222 18:8479307-8479329 CATACAGGAAAGAAGTAAAATGG - Intergenic
1153907694 18:9677621-9677643 AAGACAGAAGAGAAGAAAAAAGG - Intergenic
1153977508 18:10282439-10282461 CTGAGAGGACAGAAGGAAAGAGG + Intergenic
1156105423 18:33653665-33653687 CTGGCAGGAGAGAGGAAACAGGG - Intronic
1156818811 18:41344544-41344566 CTGAAAGGAGAAAAGAAAGAAGG + Intergenic
1157909145 18:51598711-51598733 TTGACAGAATGGAAGAAAAATGG + Intergenic
1158229247 18:55234976-55234998 CGGACATGATAGAAGACAGATGG - Intronic
1158396976 18:57087052-57087074 CTGAGAGGATAGAAGCAAGATGG - Intergenic
1159091791 18:63858102-63858124 AAGACAGGATAGAAGGAAAGAGG - Intergenic
1159680167 18:71340134-71340156 CTGAAAGTAAACAAGAAAAATGG + Intergenic
1161877042 19:6919685-6919707 ATGACTGGAGAGAAGAAAGACGG + Exonic
1162124876 19:8494098-8494120 CTGATAGGAAAAAAGAAAAAAGG - Intronic
1164079956 19:21853531-21853553 CTTACAGGAAAAAAAAAAAAAGG - Intergenic
1164489553 19:28694225-28694247 CTGGAAGGAGAGGAGAAAAAAGG + Intergenic
1164815056 19:31192211-31192233 AAGACAGGAAATAAGAAAAAGGG + Intergenic
1166531031 19:43543688-43543710 CTGGCGGGAGAGAAGAAAAGAGG + Intronic
1167971801 19:53192613-53192635 CTGAGAGAAAAGTAGAAAAACGG - Intronic
925088299 2:1131428-1131450 CTGACAGGATGGAAGTCAAATGG - Intronic
925359045 2:3264551-3264573 CGGGCAGGACAGATGAAAAAAGG + Intronic
925496385 2:4454257-4454279 CTAACAGGAAAGGAGATAAAAGG + Intergenic
925585741 2:5462234-5462256 CTGACAGGACAGGATAAAGATGG + Intergenic
925721311 2:6830404-6830426 CAGAAAGGAAAGAAGAAAAGGGG + Intergenic
927767153 2:25821350-25821372 CTGTCAGGAAAGAAAGAAAAAGG + Intronic
928074828 2:28254610-28254632 GAGGCAGGATAGAAGAAACAAGG - Intronic
928300359 2:30118833-30118855 CTGCCATGATAGAACAAAAATGG + Intergenic
928465267 2:31517623-31517645 CTGAGAGTAGAGAAGAAACAAGG - Intergenic
928855942 2:35802783-35802805 TCGACAAGATAAAAGAAAAAAGG + Intergenic
928932672 2:36640371-36640393 ATGACAGGAAGGAAGAAAAGAGG + Intronic
928970171 2:37019793-37019815 TTGCCAGGTAAGAAGAAAAATGG - Exonic
929093567 2:38243137-38243159 CTGACATGGAAGAAGAAAAATGG - Intergenic
929122269 2:38493463-38493485 TTGACAAGGAAGAAGAAAAATGG - Intergenic
929279469 2:40062128-40062150 CGAACAAGATGGAAGAAAAATGG - Intergenic
929509307 2:42554489-42554511 CTTAGAGGAAAGAAGGAAAAGGG + Intronic
930595521 2:53383033-53383055 CTGGGAGGAGAGAGGAAAAAGGG + Intergenic
930984744 2:57571433-57571455 GTGAAAGGACAGAATAAAAAAGG - Intergenic
931086610 2:58838252-58838274 CCCACAAGAAAGAAGAAAAAAGG - Intergenic
931471438 2:62541688-62541710 CAGACAGGAGAGAAGGAGAAGGG + Intergenic
931494500 2:62787684-62787706 ATGAAAGAATAGATGAAAAAAGG + Intronic
931769312 2:65484140-65484162 CTGACTGGTTACAAGAGAAAAGG + Intergenic
931897884 2:66753492-66753514 TTGACTGGATAGAAAAAAAGAGG + Intergenic
932034426 2:68227922-68227944 CAGATTGGAAAGAAGAAAAACGG - Intronic
932185567 2:69692555-69692577 CTGACAGCCTAGTAGAAAACAGG - Intronic
932190489 2:69737844-69737866 CTAACAGGAAAAAAGAGAAAAGG - Intronic
932289440 2:70563748-70563770 CTAAGAGTATAGATGAAAAAAGG + Intergenic
932843562 2:75109904-75109926 CTGAAAGGAGAGCAGAAAAGAGG + Intronic
933061142 2:77738062-77738084 GTGACAGGATTGAAGGAACATGG - Intergenic
933303338 2:80567523-80567545 ATGACAGAAGAGAGGAAAAAAGG - Intronic
933352180 2:81168090-81168112 CTGACAGCCTACAAGAAAACAGG - Intergenic
933885739 2:86718655-86718677 CTGCCAAGAGGGAAGAAAAATGG + Intronic
933924439 2:87078050-87078072 CTGCCAAGAGGGAAGAAAAATGG - Intergenic
934910726 2:98251917-98251939 CTGAGAGGAAAGAAGAACCAAGG + Intronic
937883014 2:126882521-126882543 CTGACTAGTTAAAAGAAAAAAGG - Intergenic
937964226 2:127489173-127489195 CTGACAGGAGAGGAGAAGTAAGG - Exonic
938061195 2:128255719-128255741 CTGGAAGGAGAGAAGAAAGAGGG + Intronic
939010083 2:136836362-136836384 CTGACAGTGAAGATGAAAAAAGG - Intronic
939171662 2:138703105-138703127 CTGACGATATAAAAGAAAAATGG - Intronic
939453793 2:142406771-142406793 CTAAGAGAATATAAGAAAAATGG + Intergenic
939665652 2:144948105-144948127 AAGGCTGGATAGAAGAAAAAGGG + Intergenic
941596234 2:167480375-167480397 CTGCGAGGCTAGAAGCAAAATGG + Intergenic
942095835 2:172535784-172535806 CTACAAGGATGGAAGAAAAAAGG + Intergenic
943028352 2:182655736-182655758 CTGACAGCACAGGAGAATAAAGG + Intergenic
943042676 2:182821763-182821785 CTTGGAGGTTAGAAGAAAAATGG + Intergenic
943918433 2:193668908-193668930 CTGCAATGATAGAAGACAAAAGG - Intergenic
944107399 2:196094034-196094056 CTGACAGAAAACAAGAAATAGGG + Intergenic
944330036 2:198454588-198454610 CTGACAGGTTACATGGAAAATGG - Intronic
944400370 2:199319407-199319429 CTGCTGGGATAAAAGAAAAAGGG - Intronic
944584048 2:201158040-201158062 CTAAAAGAACAGAAGAAAAATGG - Intronic
945346756 2:208727089-208727111 CTGACGAGATTGAAGAGAAAAGG - Intronic
945398420 2:209350098-209350120 CAGACGGGATAGAAGTGAAACGG + Intergenic
945564945 2:211386151-211386173 CTGTTAGCATAGAAGAAGAAAGG + Intronic
945623883 2:212175844-212175866 GTGACAAGAAAGAAGAAGAAGGG - Intronic
946348602 2:219131931-219131953 CTGACATGATGGAAGAATACTGG + Intronic
946665831 2:222049227-222049249 CTAGCAGGTTAGAAGAAATAGGG - Intergenic
946672491 2:222121208-222121230 AAGACAGAATAGAAGAAAGAGGG + Intergenic
946760226 2:222986037-222986059 CTGTGAGGCTAGAAGCAAAATGG + Intergenic
947045920 2:225983702-225983724 CTGACATTATACAAGCAAAAAGG + Intergenic
947252336 2:228121895-228121917 CTGGCAGGATATGAGAAAGATGG + Intronic
948624337 2:239259765-239259787 CTGACAATGTTGAAGAAAAAAGG + Intronic
948678893 2:239618194-239618216 ATTACAGCATAGAAAAAAAAAGG - Intergenic
948857908 2:240738835-240738857 CAGACAGGAGAGAAGGAAGAGGG - Intronic
1169475036 20:5923439-5923461 CTGACACCAGAGAAGAGAAAAGG + Exonic
1169612878 20:7402811-7402833 CTGGCAATATTGAAGAAAAATGG - Intergenic
1169628779 20:7601320-7601342 CTGACAGGAGAAAAGCAAAGGGG - Intergenic
1169635794 20:7690038-7690060 CTCACATGGTAGAAGGAAAAAGG - Intergenic
1169719433 20:8657753-8657775 TTGAAAGATTAGAAGAAAAAAGG + Intronic
1170504478 20:17010723-17010745 CTGACAGGTTAATAGGAAAAAGG - Intergenic
1171129482 20:22637175-22637197 CTGAAAGAATTGAAGAAAAATGG - Intergenic
1171180368 20:23086829-23086851 ATGGGAGGATAAAAGAAAAAAGG - Intergenic
1171394800 20:24825112-24825134 CTCACATGGTAGAAGACAAAGGG + Intergenic
1171539858 20:25940536-25940558 GTGACAGGATTGAAGGAAGAGGG - Intergenic
1172125036 20:32620752-32620774 CTGGCATGATAGATGAAAATAGG + Intergenic
1172820573 20:37729818-37729840 CAGACAGGCTACAATAAAAAAGG - Intronic
1173205660 20:40991221-40991243 CAGACAACAAAGAAGAAAAATGG - Intergenic
1176921025 21:14687514-14687536 ATGACAGGAAAGCAGAAGAAAGG + Intergenic
1177677272 21:24316886-24316908 CTTACAGCATAGGAGAAAAAAGG + Intergenic
1178400320 21:32279605-32279627 CTTACAAAAAAGAAGAAAAAGGG - Intergenic
1178557229 21:33603150-33603172 CTAACAGGAATGAATAAAAATGG + Intronic
1179076088 21:38123141-38123163 GGGTCAGAATAGAAGAAAAACGG - Intronic
1180285737 22:10742573-10742595 CTGACATTTTAGAAGAAAAATGG - Intergenic
1182747964 22:32620388-32620410 CTGAGAGGATTCAAGGAAAATGG - Intronic
1182821483 22:33220601-33220623 CTCAGAGGAGAGAAGAAACAGGG - Intronic
1182964866 22:34511406-34511428 AAGACAGGATAGAAAGAAAATGG + Intergenic
1183756109 22:39766874-39766896 ATGAGAGGATGGAAGAAAAATGG - Intronic
949094077 3:65111-65133 ATGATAGGTTAGAAGAAAAAGGG + Intergenic
949607557 3:5671131-5671153 CTCACAGGGTGGAAGACAAAAGG - Intergenic
950266250 3:11575268-11575290 CTGACAGGAGAGCAGCAGAATGG - Intronic
950291899 3:11791372-11791394 CTTAGGGGAAAGAAGAAAAAGGG + Intronic
950626326 3:14249914-14249936 CTGAAAGCATAGTAGAGAAATGG + Intergenic
951007967 3:17641004-17641026 ATGAAAGGAAAGCAGAAAAATGG - Intronic
951520597 3:23607509-23607531 CTGATAAGAAAGAAGAATAAAGG - Intergenic
952287816 3:31984859-31984881 CTTACAGGTTAGAAGCAAGATGG + Intronic
953038096 3:39230699-39230721 CTGGAAGGATAGAAGGATAAAGG - Intergenic
953292266 3:41677212-41677234 ATGACTGGATAGAAAACAAATGG - Intronic
953451153 3:43007495-43007517 CTGATAGGATAAAAAACAAAAGG - Intronic
953567005 3:44041299-44041321 GTGACAGGAAAAAAAAAAAAAGG + Intergenic
953828961 3:46278803-46278825 CTCACAGAATGGAAGAAAGAAGG - Intergenic
954652163 3:52171850-52171872 TGGACAGGAGAGAAGAGAAAGGG + Intergenic
954701354 3:52452482-52452504 CTGACAGAAGAGCAGAAAAATGG - Exonic
955035490 3:55263344-55263366 TGGACAGGAATGAAGAAAAAAGG - Intergenic
955467710 3:59253858-59253880 CAGAAAGGGTAGAAGAATAAGGG - Intergenic
956701950 3:71966477-71966499 CTGACAGGAGAGAAGGCAAGAGG + Intergenic
957066405 3:75526412-75526434 CTTACAGGCTAGGAGAAAAGGGG + Intergenic
957218984 3:77357824-77357846 TTTAAGGGATAGAAGAAAAAAGG + Intronic
957507481 3:81141694-81141716 TTGACTGGAGAGAAGAAACAGGG + Intergenic
958477709 3:94605785-94605807 CAGAAAGGTTAGAAGAAAACTGG + Intergenic
958541735 3:95485045-95485067 ATGACAGGATAACATAAAAAGGG + Intergenic
959115594 3:102174207-102174229 CACACAAGATAGAAAAAAAATGG + Intronic
959152907 3:102629116-102629138 CTGTGAGGCTAGAAGCAAAATGG - Intergenic
959776512 3:110170943-110170965 GTGAAAGGAAAGAAGAAGAAAGG - Intergenic
961540943 3:127598864-127598886 CAGACAGTATACAAGACAAAGGG - Intronic
962850687 3:139306449-139306471 CTGAAAGGAAGGATGAAAAATGG + Intronic
963374502 3:144446775-144446797 CTGACAGGATGTAAGAATTAAGG + Intergenic
963723677 3:148894070-148894092 CAGAGAGGAAGGAAGAAAAATGG + Intronic
963931750 3:151010559-151010581 CTGATTGGATAGAAGTAAAAAGG + Intergenic
963941865 3:151103874-151103896 CTGAGAGGTGAGAAGTAAAATGG - Intronic
964095700 3:152928941-152928963 ATGACAGGAGACAAGAAGAAAGG + Intergenic
964423287 3:156527654-156527676 CTGAGAGGACAGGAGGAAAAGGG - Intronic
964828026 3:160850978-160851000 CTGACAGGAGAGAGAAAACAGGG - Intronic
969467616 4:7366894-7366916 CTGACAGAATAAATGAACAAAGG - Intronic
969499868 4:7546183-7546205 CTCCCACGATAGAAGAAAAGTGG - Intronic
969743059 4:9047426-9047448 CTTACAGGCTAGGAGAAAAGGGG - Intergenic
969964216 4:10977530-10977552 CTAACAGAATATAATAAAAATGG + Intergenic
970083406 4:12316368-12316390 CTGTGGGGATAGAAAAAAAATGG - Intergenic
970113562 4:12667775-12667797 CTCACATGGTAGAAGAAACAAGG + Intergenic
970563538 4:17308181-17308203 CAGACAGGTTAAAAGAAAAGTGG + Intergenic
970625230 4:17869904-17869926 CTTAAAGATTAGAAGAAAAAAGG - Intronic
970733606 4:19138883-19138905 ATGAAAGGATAGAGAAAAAATGG - Intergenic
970973179 4:22009540-22009562 CCAATAGGATAAAAGAAAAATGG - Intergenic
971073827 4:23125599-23125621 CTGCCAAGATAGATGAAACAAGG + Intergenic
971521744 4:27561257-27561279 CCTACAGAATAGAAGAAAATTGG + Intergenic
971523926 4:27591659-27591681 CTGAAAGGAAAGAAAGAAAAAGG + Intergenic
971975565 4:33681662-33681684 CTGTGAGGCTAGAAGAAAGATGG + Intergenic
972100786 4:35413039-35413061 CTCACAGGAAAAAAAAAAAAAGG + Intergenic
972141650 4:35968048-35968070 CTCACAAGAGAGAAGATAAAGGG + Intronic
972274655 4:37545807-37545829 CTGACAGAATGGAAGAACAGTGG - Intronic
973119694 4:46506031-46506053 ATGAAAGAAGAGAAGAAAAAAGG + Intergenic
973595780 4:52488010-52488032 CTGTCAAAAAAGAAGAAAAAAGG + Intergenic
973640981 4:52902301-52902323 CTCACAGTGGAGAAGAAAAAGGG + Intronic
973659571 4:53089002-53089024 CTCACATGATAGAAGAAGTAGGG - Intronic
975185795 4:71400853-71400875 TGGACAGGAAAGAAAAAAAAAGG + Intronic
975302364 4:72805230-72805252 CCAAAAGGAGAGAAGAAAAAAGG + Intergenic
975566057 4:75755590-75755612 CTGTCTGGGGAGAAGAAAAAAGG - Intronic
975698479 4:77038677-77038699 CTTACTGGATAAAAGAAATAGGG + Intronic
975755590 4:77568435-77568457 CTGAGAGGAGAAAAGTAAAATGG - Intronic
976205050 4:82616612-82616634 CTGAAAGGCTGGAAGAAGAAAGG - Intergenic
976684158 4:87792427-87792449 CTGACAGGAAAGAAGGGAGAAGG + Intergenic
977672671 4:99714429-99714451 CTGTGAGGCTAGAAGCAAAATGG - Intergenic
977734139 4:100391571-100391593 CTGCCAGGAAAGAAGCACAAGGG - Intergenic
978020241 4:103800416-103800438 CTGAGAGAAAATAAGAAAAAAGG + Intergenic
978669270 4:111226858-111226880 CTCACATGGTAAAAGAAAAAAGG + Intergenic
979655122 4:123183665-123183687 CTAACACAATAAAAGAAAAATGG + Intronic
979871661 4:125830505-125830527 CTAACAAGATAGAAGTAAACAGG - Intergenic
979949681 4:126876437-126876459 TTGAAAGGAAAGAAGACAAAGGG - Intergenic
980464366 4:133153022-133153044 CTGACAGGATGGAAGAGCAAAGG - Intronic
980817296 4:137965118-137965140 GTGACAGGATATAAGTAAAAGGG + Intergenic
980900757 4:138902798-138902820 CTCACACGATGGAAGAATAAAGG + Intergenic
980981560 4:139658618-139658640 GTGCCAGGATAGAGGAGAAAGGG - Intergenic
981007847 4:139893960-139893982 ATGACAGGGTAGGAGAGAAAAGG + Intronic
981205914 4:142040168-142040190 GTGACAGGAGAGAAGACAAGGGG + Intronic
981655269 4:147105380-147105402 CTGACCAGAAAGAGGAAAAATGG + Intergenic
981945155 4:150333622-150333644 CTGAAGGGAAAGAAGAAAACTGG - Intronic
982179510 4:152736777-152736799 ATGACAGGATAAAAGAAAATGGG - Intronic
982239673 4:153286639-153286661 CTGACATCATAGAAATAAAAAGG - Intronic
982383645 4:154776855-154776877 CTGACGAGAAAAAAGAAAAAAGG - Intergenic
982388028 4:154833851-154833873 ATGACAGGATAAAAGTGAAATGG + Intergenic
982675383 4:158369017-158369039 CTGAAAGGGTAAATGAAAAATGG - Intronic
982878441 4:160677227-160677249 TTTAGAGGAGAGAAGAAAAAAGG + Intergenic
982943766 4:161592077-161592099 CTACCAGGTTTGAAGAAAAAAGG + Intronic
983185339 4:164694248-164694270 CTCACAGGAAAGAAAAAAAATGG - Intergenic
983762768 4:171433006-171433028 ATGAGAGGAAAGAAGAAAAAGGG + Intergenic
984070543 4:175106505-175106527 ATGACAGTCTAGAAGAAATAAGG + Intergenic
984176004 4:176417743-176417765 CTGGCAGTACAGAAGAGAAAAGG - Intergenic
984233444 4:177128650-177128672 CTCACAGGCCAGAAGAAAATTGG - Intergenic
984610560 4:181832491-181832513 CTAAGAGGATTGCAGAAAAATGG - Intergenic
984675898 4:182547480-182547502 CTGACATGAAAGAAAACAAAGGG - Intronic
984825769 4:183923399-183923421 CTGAGAAGTTAGAAGAAAACTGG + Intronic
984923033 4:184782666-184782688 CTGACAGGACAGAATAAAAATGG + Intronic
985442768 4:189996294-189996316 CTGACTGGATAGAGAAAATATGG - Intergenic
986888480 5:12270268-12270290 CTGAAAGTATTGAGGAAAAAGGG + Intergenic
987560871 5:19518528-19518550 CAGACAGGCTAGAATAAAACAGG + Intronic
987999626 5:25331321-25331343 CTGACAGCAGAGAAGACAATGGG + Intergenic
988185517 5:27855796-27855818 CTGAGACCATACAAGAAAAAGGG + Intergenic
988494056 5:31729572-31729594 CTTCCAGGGTAGTAGAAAAAAGG - Intronic
988710290 5:33767284-33767306 CTGAAAGTATAGAAGAGAGAAGG - Intronic
989497231 5:42123653-42123675 CTACCAGAATAAAAGAAAAAAGG - Intergenic
989691245 5:44146952-44146974 CTCACATGGTAGAAGACAAAAGG - Intergenic
990400366 5:55431358-55431380 CTTACAGGCTAGGAGAAAATGGG + Intronic
990413234 5:55561826-55561848 CTGACTGGATTGTAGAATAAGGG + Intergenic
990662657 5:58034725-58034747 GAGACAGGACAGAGGAAAAAGGG - Intergenic
990779706 5:59346196-59346218 GTGACTGGAAAGAAGAATAAAGG + Intronic
990805865 5:59660987-59661009 CTGAAAGGATACAGGAGAAAGGG + Intronic
993436188 5:87898585-87898607 ATGAAAAGATAGAAGAAAAAAGG + Intergenic
993653082 5:90545399-90545421 TTGAAAGGAAAGAAGAAGAAAGG - Intronic
994466526 5:100140137-100140159 CTGAGAGCAAAGAGGAAAAAAGG + Intergenic
994592502 5:101790474-101790496 ATGACAGGAAAAAAAAAAAAAGG - Intergenic
995191827 5:109326032-109326054 ATGAAAGGAAAGGAGAAAAACGG + Intergenic
995399699 5:111726997-111727019 CAGACAGGATATAAGAAAAGAGG + Intronic
995503822 5:112837471-112837493 ATAAAAGGATAGAAGACAAAAGG - Intronic
996065444 5:119073859-119073881 TTAACATGAGAGAAGAAAAAAGG - Intronic
996330648 5:122324910-122324932 CTGACAGCATAGAAATAACATGG + Intronic
996529618 5:124514336-124514358 TAGAGAGGAGAGAAGAAAAAGGG - Intergenic
998722823 5:144974293-144974315 TTGACAGGAAAGAGGGAAAAAGG + Intergenic
999041344 5:148416614-148416636 CTGACAAGAGAGAACATAAATGG - Intronic
999361127 5:150987656-150987678 CTGACAGGGAAGAAGAATAAAGG + Intergenic
999426231 5:151489846-151489868 GTGACGGGACAGAAGAGAAAAGG - Exonic
999806033 5:155082148-155082170 CTGAGAGGTTAGAAGCAAGATGG + Intergenic
999875025 5:155794996-155795018 CTGACATGCTAGCAGAACAATGG + Intergenic
1001243218 5:170086024-170086046 CTGAAAGCCTAGAAGAAAGAAGG - Intergenic
1001997066 5:176170681-176170703 CTGGCAGGAAGGAAGAAAAGGGG + Intergenic
1003291194 6:4779658-4779680 CTGCTAGGATTGAGGAAAAACGG + Intronic
1003495507 6:6660144-6660166 ATGACAGCACAGAACAAAAAGGG + Intergenic
1004564655 6:16784863-16784885 CTGACAAGATTGCAGAGAAAAGG + Intergenic
1004565633 6:16794115-16794137 CCGACAGGAAGGAAGAAAACAGG + Intergenic
1006180314 6:32150269-32150291 CTGGTAGGATAGAGGAACAAGGG - Intronic
1006644842 6:35509062-35509084 GTGACAGGATATAAGGACAAAGG - Intronic
1007283276 6:40728568-40728590 CTTACAGGATAGAAGAGATGAGG + Intergenic
1007307641 6:40919291-40919313 ATGAAAGGAAGGAAGAAAAACGG + Intergenic
1007898369 6:45385921-45385943 CTGAGTAGAAAGAAGAAAAAGGG - Intronic
1008137886 6:47797826-47797848 CTGACAGGAGAGAAGATGATGGG - Intronic
1008151695 6:47960277-47960299 CTGATAGAAAAGATGAAAAAGGG + Intronic
1008383846 6:50864628-50864650 ATGAAAGGATAGAAGGTAAAGGG - Intergenic
1008599738 6:53080196-53080218 GTTACAGGAAAGAAAAAAAAAGG - Intronic
1009236638 6:61132331-61132353 CTGACAGGACAGAAGAGACTGGG - Intergenic
1009717121 6:67412243-67412265 CTTAAAGGTTAGAAGCAAAATGG - Intergenic
1011150889 6:84272171-84272193 CTAACAGGATACAAGCAAGAGGG + Intergenic
1011508323 6:88072375-88072397 ATGACAGCATAGAAGCAAACTGG - Intergenic
1012154715 6:95803894-95803916 CAGACAGTATAGTAGCAAAATGG - Intergenic
1013045558 6:106481681-106481703 CTGGCAGGAGATAAGAAAAAGGG + Intergenic
1013206029 6:107946649-107946671 CTGTCAGGATAGAACAAAGAAGG + Intronic
1014182681 6:118402748-118402770 AAGATAGGATAGAAAAAAAAAGG + Intergenic
1014382956 6:120766830-120766852 CTGTCAGGACATAAGAGAAAGGG - Intergenic
1014484104 6:121977936-121977958 ATTACAGGGTAGAACAAAAAGGG - Intergenic
1015736611 6:136406900-136406922 CTGAGAGGATCTCAGAAAAATGG - Intronic
1016538369 6:145134894-145134916 CAGAGAAGATAAAAGAAAAAAGG - Intergenic
1016539382 6:145146911-145146933 GTCATAGGATAGAAGACAAATGG + Intergenic
1017593094 6:155998052-155998074 CTGAAAGGACAGAGAAAAAAGGG + Intergenic
1017742061 6:157415538-157415560 CATTCAGGATAGAAAAAAAATGG - Intronic
1017932817 6:158974385-158974407 CTTCCAGCATAGAAGAAAATGGG - Intronic
1018179662 6:161210397-161210419 GAGACAGGATAAAACAAAAAAGG + Intronic
1019025013 6:168952766-168952788 CTGAAAGGAATTAAGAAAAATGG - Intergenic
1021180408 7:17499028-17499050 CTTAAAGGTTAGAAGAAAGATGG + Intergenic
1021334579 7:19383598-19383620 TTGACAAGATATAAGAAAACAGG - Intergenic
1022185315 7:27961615-27961637 GTGGCAGGAAAGAAGGAAAAAGG + Intronic
1022193909 7:28045055-28045077 CAGGCAGGAAGGAAGAAAAAAGG + Intronic
1022744427 7:33155844-33155866 CTGAAAGAATAAATGAAAAATGG - Intronic
1022886979 7:34656801-34656823 CTGACAAGATTGAAGGGAAACGG - Intergenic
1023706669 7:42948542-42948564 CTGAAATGATATAATAAAAAGGG - Intronic
1025112032 7:56225341-56225363 TTGACAGCATTTAAGAAAAAGGG - Intergenic
1026125811 7:67578643-67578665 CTGCCATGAGAGAAGAAATAGGG - Intergenic
1026307812 7:69157087-69157109 CCAACAGGATACAAGAACAAAGG - Intergenic
1026410550 7:70117420-70117442 GAGACAAGACAGAAGAAAAAAGG + Intronic
1026600925 7:71776658-71776680 CTGAGAGCAGAGAAGAAAGATGG + Intergenic
1026807666 7:73438039-73438061 CTGACAGCAAGGAAGAAAGAAGG - Intergenic
1028115806 7:86996310-86996332 CTGTCAGCATAGAGGAGAAATGG + Intronic
1028210220 7:88064661-88064683 CAGACAGGATAGAAGGGCAAAGG + Intronic
1029070295 7:97890494-97890516 CTTACAGGCTAGGAGAAAAGGGG + Intergenic
1030137164 7:106265469-106265491 CTGACAGGTTAGATTAAAGAAGG - Intronic
1030188030 7:106782256-106782278 CTGACAGGATAGAAGAAAAAGGG - Intergenic
1030592365 7:111497587-111497609 AAGACAGGACGGAAGAAAAAAGG + Intronic
1030841714 7:114361359-114361381 CTGACAGTATAAAAGGAAAGAGG + Intronic
1031185942 7:118480519-118480541 CTCACATGACAGAAGAAAGAAGG + Intergenic
1031195951 7:118613270-118613292 CTTACAAGCTGGAAGAAAAATGG + Intergenic
1034703244 7:153115730-153115752 TTGATAAGAAAGAAGAAAAAGGG + Intergenic
1036248268 8:7139208-7139230 CTTACAGGCTAGGAGAAAAGGGG - Intergenic
1036252542 8:7175143-7175165 CTTACAGGCTAGGAGAAAAGGGG + Intergenic
1036893592 8:12612847-12612869 CTTACAGGCTAGGAGAAAAGAGG + Intergenic
1037164068 8:15805773-15805795 CTCACAGGACACAACAAAAAAGG - Intergenic
1037288693 8:17328180-17328202 CTGATAGGAAAGAAGCAACAGGG - Intronic
1037426312 8:18758814-18758836 CTGACAAGATAGGTTAAAAACGG + Intronic
1038486591 8:27939670-27939692 CTAACTGGATGGAAGAAGAAAGG + Intronic
1039062838 8:33585469-33585491 AGGACTGAATAGAAGAAAAATGG - Intergenic
1040377920 8:46844386-46844408 CAGACAGGGTTGAAGAAAAAGGG - Intergenic
1040380103 8:46864312-46864334 CAGACAGGGTTGAAGAAAAAGGG - Intergenic
1041396868 8:57400671-57400693 CTCAGAGGATAGAAGCAAAATGG - Intergenic
1041589142 8:59556576-59556598 CTGACATAATAGAAGAAAGCTGG + Intergenic
1041818905 8:62006429-62006451 CTGAAAGGTTGGAAGAAAGAGGG + Intergenic
1041984253 8:63901902-63901924 CTGACAGGATACTTGAAGAATGG - Intergenic
1042510347 8:69604713-69604735 GTGACAGGGTAAAAAAAAAAAGG + Intronic
1045211222 8:100102088-100102110 CTGGCAGAAAAGAAGAAAAAGGG + Intronic
1045350176 8:101331192-101331214 CTGACAGGGTAGAATACAGAGGG - Intergenic
1045437592 8:102179684-102179706 GGGACAGAATAAAAGAAAAAAGG + Intergenic
1045608698 8:103809501-103809523 CTCACAGGAAAGAAAGAAAAAGG - Intronic
1045648008 8:104317985-104318007 CTGAGAGGCTAGAAGCAAGATGG + Intergenic
1045820245 8:106328875-106328897 CTGACAGCAGAAATGAAAAAGGG - Intronic
1045994033 8:108342372-108342394 CTTGGAGGTTAGAAGAAAAATGG - Intronic
1046215395 8:111139556-111139578 CTTACACGACAGAAAAAAAATGG - Intergenic
1046902617 8:119539260-119539282 CTGTCAGGATAGACCAACAATGG + Intergenic
1046967977 8:120188471-120188493 CAGAAAGTATAGAAGAGAAAGGG + Intronic
1047691399 8:127358425-127358447 CTGTTAGGCTAGAAGTAAAATGG - Intergenic
1047712482 8:127566494-127566516 CTGCCAAGATAGAAGGAAAGGGG - Intergenic
1047806863 8:128370269-128370291 CTTACAGGGTAGAAGCAAGATGG - Intergenic
1048507703 8:135035602-135035624 CTCCCAGGTTAGAAGACAAAAGG - Intergenic
1049023003 8:139970605-139970627 CTCACAAGAGGGAAGAAAAAGGG + Intronic
1049930269 9:449411-449433 CTGACAGGGTAGAAAAAACATGG + Intronic
1049984301 9:933914-933936 CCGACAGGATAGGAGAATAAGGG - Intronic
1050754501 9:8984588-8984610 CTGAGAAGTCAGAAGAAAAATGG - Intronic
1050761298 9:9074957-9074979 CTGACAATATAGAACAAAGATGG + Intronic
1051234279 9:14982163-14982185 CAGACAAGATAGAAGAAATCTGG - Intergenic
1051433367 9:17003617-17003639 CTGAGAGTATAAAAAAAAAAAGG + Intergenic
1051677152 9:19569980-19570002 GTGATAGGATGGAAGGAAAATGG - Intronic
1051826281 9:21224129-21224151 CTGATGGCATAGAAGTAAAAAGG + Intronic
1052467464 9:28847352-28847374 CTGACTGAATTGAAAAAAAATGG - Intergenic
1052603429 9:30670090-30670112 CTCACATGACAGAAGAAATAAGG - Intergenic
1052735344 9:32336261-32336283 CTTAAAGGAAAGAAGAATAAGGG + Intergenic
1053373631 9:37585251-37585273 CTAAAAGGATGGAAGAAAAGAGG + Intronic
1054730779 9:68700974-68700996 CTGAGAGGAAAGAGGAACAAGGG + Intergenic
1054985278 9:71254862-71254884 ATGAAAGGAAAGAAGACAAAGGG + Intronic
1055274099 9:74594848-74594870 CTTACAGGATAGATGAAAATTGG - Intronic
1056640207 9:88363345-88363367 CTTACAGGTTAGAAGCAAGATGG + Intergenic
1056927264 9:90845563-90845585 CTGATAGGATCAAAGACAAATGG + Exonic
1057096875 9:92318844-92318866 GTGAGAGGAAAGAAAAAAAAAGG + Intronic
1057469687 9:95346439-95346461 CAGACAGGATAGAAAAAATATGG - Intergenic
1057547451 9:96028632-96028654 CTCATAGAATAGAAGGAAAAGGG - Intergenic
1057943234 9:99303167-99303189 CCCACAGAATAGAAAAAAAAAGG + Intergenic
1057994001 9:99803013-99803035 CAGACAGGATAAATGAAAAAGGG + Intergenic
1058021267 9:100091610-100091632 CTGAATGGAATGAAGAAAAAGGG - Intronic
1058105165 9:100962198-100962220 CTGACAGGATTGAATCAAGATGG - Intergenic
1060899082 9:127241650-127241672 CTGACAAGAGAGAAGACAAAGGG + Intronic
1061918023 9:133767060-133767082 TAGGCAGGAAAGAAGAAAAAAGG + Intronic
1203732090 Un_GL000216v2:99639-99661 CTGGCATTTTAGAAGAAAAATGG - Intergenic
1185509551 X:652799-652821 CTTGCCGGACAGAAGAAAAATGG + Intronic
1186153001 X:6695597-6695619 CTTACAGGTTAGAAGCAAGATGG - Intergenic
1187001925 X:15190172-15190194 CTGATATGATAGGTGAAAAATGG + Intergenic
1187087077 X:16051752-16051774 CTTACAGGTTAGAAGCAAGATGG + Intergenic
1187703887 X:21990381-21990403 CTGGCACTATCGAAGAAAAAGGG - Intronic
1188139666 X:26534095-26534117 CTGAGAGGATGGAATAATAATGG + Intergenic
1188150553 X:26669405-26669427 CTGAGAAGATAGGAGAGAAAAGG + Intergenic
1188820158 X:34765369-34765391 CTGAGAGGATGGGAGAAAGAGGG - Intergenic
1189275150 X:39779999-39780021 CTCACAGGATAAAAAAAGAAGGG + Intergenic
1191818278 X:65273401-65273423 CTGTCTGAATAGAAAAAAAAAGG + Intergenic
1192938092 X:75881978-75882000 ATGGAGGGATAGAAGAAAAAAGG - Intergenic
1193019636 X:76777597-76777619 CTGAAAGTATAAAAAAAAAAAGG + Intergenic
1193142998 X:78048498-78048520 ATGAAAGGATAAAAGAGAAAAGG - Exonic
1193530796 X:82651510-82651532 CAGAAAGGATACCAGAAAAATGG + Intergenic
1193716738 X:84942813-84942835 GTGCCATGATAGAATAAAAATGG - Intergenic
1194248862 X:91548084-91548106 TTCAAAGGAGAGAAGAAAAAGGG + Intergenic
1194641504 X:96408662-96408684 CTGAAAGGTTAGAAGCAAGATGG - Intergenic
1194689456 X:96964978-96965000 CTTAGAGGATAGAGGAATAAAGG + Intronic
1194967874 X:100309765-100309787 AAGACAAGACAGAAGAAAAAAGG + Intronic
1195222551 X:102760350-102760372 CTGACAGGGAAAAAAAAAAAAGG + Intergenic
1195786469 X:108529128-108529150 CTTACAGGCCAGAAGAGAAAGGG + Intronic
1195994587 X:110719103-110719125 TTGACTGGATAGAAGGAAAAAGG + Intronic
1196140742 X:112260609-112260631 ATGACAGGATATAATAAAGATGG - Intergenic
1197038680 X:121908326-121908348 ATGAGAAGAAAGAAGAAAAAAGG - Intergenic
1197066940 X:122244931-122244953 TTCACAGCATAAAAGAAAAAAGG - Intergenic
1197787381 X:130212419-130212441 CCAAAAGGAAAGAAGAAAAATGG + Intronic
1197992505 X:132333133-132333155 CCAACAAGATAGAAGGAAAATGG - Intergenic
1198892871 X:141418744-141418766 CAGACTGGATAAAAGAAATATGG + Intergenic
1198919575 X:141710121-141710143 CTGAGAGGATAGAGGAGAAGGGG + Intergenic
1199198373 X:145058749-145058771 CTGACAGCAAAGAGGATAAAAGG + Intergenic
1200082355 X:153584178-153584200 CTGCCAAGAGAGGAGAAAAATGG + Intergenic
1200567873 Y:4789620-4789642 TTCAAAGGAGAGAAGAAAAAGGG + Intergenic
1200865094 Y:8034996-8035018 TAGACAGGAAAGAAGAAAAAGGG - Intergenic
1201233260 Y:11886414-11886436 CTTAGAGGTTAGAAGCAAAATGG - Intergenic
1202170358 Y:22036890-22036912 CTGACAGGATAGAATAGAGGAGG - Intergenic
1202221007 Y:22549483-22549505 CTGACAGGATAGAATAGAGGAGG + Intergenic
1202322105 Y:23646180-23646202 CTGACAGGATAGAATAGAGGAGG - Intergenic
1202548663 Y:26023876-26023898 CTGACAGGATAGAATAGAGGAGG + Intergenic