ID: 1030192757

View in Genome Browser
Species Human (GRCh38)
Location 7:106825793-106825815
Sequence ACTTACACACCAATCTCCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030192757_1030192759 -8 Left 1030192757 7:106825793-106825815 CCAGAGGAGATTGGTGTGTAAGT No data
Right 1030192759 7:106825808-106825830 GTGTAAGTCAGTGGAGTGAGTGG No data
1030192757_1030192762 19 Left 1030192757 7:106825793-106825815 CCAGAGGAGATTGGTGTGTAAGT No data
Right 1030192762 7:106825835-106825857 GATCCACCTTTGATGTGGCCAGG No data
1030192757_1030192761 14 Left 1030192757 7:106825793-106825815 CCAGAGGAGATTGGTGTGTAAGT No data
Right 1030192761 7:106825830-106825852 GGAAAGATCCACCTTTGATGTGG No data
1030192757_1030192760 -7 Left 1030192757 7:106825793-106825815 CCAGAGGAGATTGGTGTGTAAGT No data
Right 1030192760 7:106825809-106825831 TGTAAGTCAGTGGAGTGAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030192757 Original CRISPR ACTTACACACCAATCTCCTC TGG (reversed) Intergenic
No off target data available for this crispr