ID: 1030192762

View in Genome Browser
Species Human (GRCh38)
Location 7:106825835-106825857
Sequence GATCCACCTTTGATGTGGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030192757_1030192762 19 Left 1030192757 7:106825793-106825815 CCAGAGGAGATTGGTGTGTAAGT No data
Right 1030192762 7:106825835-106825857 GATCCACCTTTGATGTGGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030192762 Original CRISPR GATCCACCTTTGATGTGGCC AGG Intergenic
No off target data available for this crispr