ID: 1030195549

View in Genome Browser
Species Human (GRCh38)
Location 7:106849769-106849791
Sequence ATGTGTCACCTAGACAATGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030195547_1030195549 -6 Left 1030195547 7:106849752-106849774 CCGTGATGGTGAATTGTATGTGT No data
Right 1030195549 7:106849769-106849791 ATGTGTCACCTAGACAATGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030195549 Original CRISPR ATGTGTCACCTAGACAATGG CGG Intergenic
No off target data available for this crispr