ID: 1030197996

View in Genome Browser
Species Human (GRCh38)
Location 7:106871528-106871550
Sequence CTTCCGTTCCTTAGGAAAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030197992_1030197996 14 Left 1030197992 7:106871491-106871513 CCTCCAGTTCCTAAAATATAAAC 0: 1
1: 0
2: 0
3: 21
4: 258
Right 1030197996 7:106871528-106871550 CTTCCGTTCCTTAGGAAAAAAGG No data
1030197990_1030197996 26 Left 1030197990 7:106871479-106871501 CCTTCCAAGAAGCCTCCAGTTCC 0: 1
1: 0
2: 2
3: 32
4: 227
Right 1030197996 7:106871528-106871550 CTTCCGTTCCTTAGGAAAAAAGG No data
1030197994_1030197996 5 Left 1030197994 7:106871500-106871522 CCTAAAATATAAACTAGAATGTG 0: 1
1: 0
2: 4
3: 48
4: 518
Right 1030197996 7:106871528-106871550 CTTCCGTTCCTTAGGAAAAAAGG No data
1030197993_1030197996 11 Left 1030197993 7:106871494-106871516 CCAGTTCCTAAAATATAAACTAG 0: 1
1: 0
2: 1
3: 20
4: 305
Right 1030197996 7:106871528-106871550 CTTCCGTTCCTTAGGAAAAAAGG No data
1030197991_1030197996 22 Left 1030197991 7:106871483-106871505 CCAAGAAGCCTCCAGTTCCTAAA 0: 1
1: 0
2: 0
3: 15
4: 179
Right 1030197996 7:106871528-106871550 CTTCCGTTCCTTAGGAAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030197996 Original CRISPR CTTCCGTTCCTTAGGAAAAA AGG Intronic
No off target data available for this crispr