ID: 1030198184

View in Genome Browser
Species Human (GRCh38)
Location 7:106874225-106874247
Sequence CTGTAGAGAAGTAGAGAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 514
Summary {0: 1, 1: 0, 2: 3, 3: 47, 4: 463}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030198184 Original CRISPR CTGTAGAGAAGTAGAGAAGA TGG (reversed) Intronic
901466300 1:9423498-9423520 CTGTAGAGAAATACAAAGGAAGG - Intergenic
902136583 1:14311478-14311500 CTATAGAGATTTAGAGAAGATGG + Intergenic
902278017 1:15353358-15353380 CTGAAGTGTAGTAGAGAAGGAGG - Intronic
903681189 1:25098415-25098437 ATTTGGATAAGTAGAGAAGAAGG + Intergenic
903754901 1:25653832-25653854 CAGTTGAGAACTGGAGAAGATGG - Intronic
904111096 1:28126759-28126781 CTGTAGAAAATTATAAAAGATGG - Intergenic
905839506 1:41162688-41162710 CTGCAGAGAACTGCAGAAGATGG + Intronic
906004181 1:42455190-42455212 GTGTACAGGAGTAGTGAAGAAGG - Intronic
906131056 1:43456837-43456859 CTCTAGAGGAGGACAGAAGAGGG + Intergenic
906160569 1:43646140-43646162 CTGTGTAGAATGAGAGAAGAGGG + Intergenic
906637818 1:47421381-47421403 CTGTAGGGAAGCAGGGAAGGTGG + Intergenic
907809023 1:57850122-57850144 CTGAAGAGAAGGAGAGAACCAGG + Intronic
908081784 1:60588568-60588590 ATGAAGAGAAATAGTGAAGAGGG + Intergenic
908092192 1:60698108-60698130 TTTTAGAGAAGTAGTGATGAAGG + Intergenic
909251922 1:73368822-73368844 ATGTAGAGAGGCAGAGAAGAAGG - Intergenic
909543538 1:76817819-76817841 TTGTAGAAAAGAAGAAAAGATGG + Intergenic
909773465 1:79455847-79455869 TTGCAGAGAAGTAGAAAAGTTGG - Intergenic
910988197 1:93027076-93027098 GTGAAGACAAGTGGAGAAGATGG - Intergenic
911229678 1:95347660-95347682 CAATAGAGAAGGAAAGAAGAGGG - Intergenic
911330302 1:96518981-96519003 CTGTCAAGGAGAAGAGAAGAAGG + Intergenic
911363313 1:96906299-96906321 ATGTGGAGTAGTAGACAAGAGGG + Intergenic
912811746 1:112800346-112800368 CTGGGGAGAAGCAGTGAAGATGG - Intergenic
914989620 1:152487025-152487047 CTGGAGAAAAGCAGAGAAGCAGG - Intergenic
915459460 1:156061168-156061190 CTGTAAGGAAGCAGAGAGGACGG - Exonic
915669060 1:157472123-157472145 CTGCAGAGAGGCAGAGAGGAAGG + Intergenic
916504352 1:165414479-165414501 CTCTAGAGAAATAGAAATGATGG + Intronic
916856605 1:168756659-168756681 CTGTAAAGTAGTATAGAATAGGG - Intergenic
917665347 1:177220531-177220553 CTCTCTAGAAGTAGAGCAGATGG + Intronic
917738785 1:177944013-177944035 ATGTAGAAACGTTGAGAAGAGGG + Intronic
917826163 1:178823448-178823470 CTGAAGAAAAGTAGAAAGGAAGG + Intronic
918743527 1:188168314-188168336 GAGTGGAAAAGTAGAGAAGAAGG + Intergenic
918913973 1:190610837-190610859 CTTTAGAGAAGTCAAGAAGTCGG + Intergenic
919038910 1:192356466-192356488 GTGTATAGAACTAGAGAAAATGG + Intronic
919479858 1:198074944-198074966 CTGTAGAGAAGGAGTGCTGATGG + Intergenic
919773710 1:201179536-201179558 CTGGAGAGAAGTGGAGAGGGTGG + Intergenic
921693595 1:218181456-218181478 CTCTAGAGCAGAAAAGAAGAGGG + Intergenic
922345643 1:224694075-224694097 CTGTGGAGGAGGAGAGGAGAGGG + Intronic
922907754 1:229187711-229187733 CTGTAGGGATGAAGAGAAGTAGG - Intergenic
923936987 1:238773136-238773158 CTATAGACAAGTAGAGCAGCAGG - Intergenic
1063310352 10:4946203-4946225 AGGGAGAGAAATAGAGAAGAGGG - Intronic
1064653528 10:17534202-17534224 CTGTAGAGAAGTGGAAAGCAAGG - Intergenic
1064680461 10:17806512-17806534 CAGCAGAGAAAGAGAGAAGAAGG - Intergenic
1065690771 10:28331268-28331290 GTGTAGAAAGGAAGAGAAGAAGG - Intronic
1065762552 10:28995774-28995796 CTGTGGAAAGGTAGAGAAGTGGG - Intergenic
1065766882 10:29038518-29038540 CTGCAGAAAAGGAGAGAAAAAGG - Intergenic
1065780587 10:29162868-29162890 GTGTAGAGGAGGAGAGAAGAAGG + Intergenic
1066404695 10:35107465-35107487 CTGGGGAGAACTAGAGAAGTAGG + Intergenic
1067267768 10:44761374-44761396 CAGAAGAGAGCTAGAGAAGATGG + Intergenic
1068627620 10:59266286-59266308 ATGTAGAGATGTAGAGAATTTGG + Intronic
1069378950 10:67822508-67822530 CTGAAGAGAAGAAGAGAGGCAGG + Intronic
1071242022 10:83717722-83717744 CTGAAGAGAAGGAGACATGAGGG - Intergenic
1071921452 10:90355495-90355517 CTGTAAAGGAGCAGACAAGATGG - Intergenic
1072566038 10:96617544-96617566 TTCTAGTGAACTAGAGAAGAAGG + Intronic
1072576888 10:96708785-96708807 CTGGTGGGAAATAGAGAAGAGGG + Intronic
1072824235 10:98590047-98590069 TTGTAGAGAAGTAGTGATCAGGG - Intronic
1072897707 10:99381083-99381105 AAGTAGAGAAGTTGAGAAGAAGG + Intronic
1073218094 10:101847798-101847820 CAGCAGGGAAGGAGAGAAGAGGG + Intronic
1073243625 10:102074339-102074361 CTGGAGAAAAGTAGGGAAGGTGG + Intergenic
1074318214 10:112377825-112377847 ATATAGAGAAGTAAAGTAGATGG + Intronic
1074369577 10:112889115-112889137 TTGTGGAGAAGAATAGAAGAAGG - Intergenic
1074592522 10:114826632-114826654 CTTTAGAGAGGCAGAGAAGATGG + Intronic
1074866548 10:117547276-117547298 CTGTTTAGAAGGAGGGAAGAGGG + Intronic
1075428924 10:122364513-122364535 CTGCATAGAAGTTGTGAAGATGG - Intergenic
1075476679 10:122741397-122741419 CTGTAGAGCAGGAGAGAATAGGG + Intergenic
1076473332 10:130735411-130735433 CTGGAGAGAAGTAAAGTACATGG + Intergenic
1077044762 11:539860-539882 CTGTGGAGAAGGAGGGAAGTGGG + Intronic
1078143014 11:8705246-8705268 GTGGAGAGAAATAGGGAAGAGGG - Intronic
1078416772 11:11172458-11172480 CAGTGGAGAAGGAGAGAAGTGGG + Intergenic
1078581241 11:12541275-12541297 CTCTAGAGAAGTCTAGAAGCAGG + Intergenic
1079016242 11:16871183-16871205 CTAAAGAGAAAGAGAGAAGATGG + Intronic
1079146202 11:17854247-17854269 CTGTAGAGAAGTCGGGGAGTTGG - Intronic
1079152406 11:17912157-17912179 TAGAAGAGAAGAAGAGAAGATGG + Intronic
1079591161 11:22184685-22184707 CAGTAGAGATTTGGAGAAGATGG - Intergenic
1079928223 11:26523103-26523125 CAGTAGAGAAGAAATGAAGAAGG + Intronic
1080023102 11:27584970-27584992 CCTTAGAGAAGTAGGGAAGCTGG - Intergenic
1080315295 11:30940375-30940397 CTGGGGAGAGGTAAAGAAGAGGG - Intronic
1080587639 11:33696003-33696025 CAGAAGAGCAGGAGAGAAGAGGG - Intergenic
1080995570 11:37596251-37596273 CTGTATTGAAATAGAGAAAATGG - Intergenic
1081075155 11:38663515-38663537 ATGTTGACAAGTTGAGAAGAGGG + Intergenic
1081199879 11:40202861-40202883 CTGCAGAGCAGGACAGAAGAGGG + Intronic
1081313907 11:41607411-41607433 CTCTAGAGGACAAGAGAAGATGG + Intergenic
1081435626 11:43024419-43024441 CTGTCGAGATGTAGTCAAGATGG - Intergenic
1081824826 11:46039058-46039080 CTGAATAAAAGTAGGGAAGAAGG + Intronic
1082115546 11:48324430-48324452 AAGTAGAGAAGTAGAGAATTTGG + Intergenic
1084443853 11:69192038-69192060 CTGTTGAGAGGTAGAGAAACAGG - Intergenic
1084470171 11:69354855-69354877 CTGTAGAGGGATAGAGTAGAAGG + Intronic
1085330339 11:75644123-75644145 CAGTAGAAAACTGGAGAAGAGGG - Intronic
1085406468 11:76266046-76266068 CTGCAGAGAGGAGGAGAAGAGGG + Intergenic
1085504160 11:77046732-77046754 CTGAACAGAAGTAGTGATGATGG - Intergenic
1086295152 11:85358104-85358126 CAGAAGGGAAGAAGAGAAGAAGG + Intronic
1086442581 11:86843773-86843795 CTGGAGAGAAGTGGAGAAATAGG + Intronic
1087086448 11:94223617-94223639 ATGTAGAGAAATAGAGAGAATGG + Intergenic
1087248327 11:95867313-95867335 ATGTAGAAATGTAGAGAAAAAGG - Intronic
1087276264 11:96163349-96163371 CTGTAGACAAATAGAAAAGCTGG - Intronic
1087739160 11:101868190-101868212 TTGTAGGGAAGTACAGAATACGG - Intronic
1087761392 11:102107644-102107666 CTAAAGTGAAGTAGAGATGAGGG + Intergenic
1087796335 11:102458247-102458269 CTGTAAAGGAGGAGACAAGAAGG - Intronic
1088108570 11:106233640-106233662 CTGTAGAGCAGAAAAGAAGATGG - Intergenic
1088217595 11:107529947-107529969 CTGTAGGGAACTAGAGAAGTAGG + Intronic
1088247357 11:107831876-107831898 TTCTAGAGTAGTAGATAAGAAGG - Intronic
1088966138 11:114723327-114723349 AAGTAAAGAAGGAGAGAAGAAGG + Intergenic
1089009348 11:115120006-115120028 CTAAAGACTAGTAGAGAAGAAGG + Intergenic
1089044626 11:115489747-115489769 CCTTAGGGAAGTACAGAAGAAGG + Intronic
1089116249 11:116097398-116097420 CTGCAGAGAAGTAGAAATTAGGG - Intergenic
1089798930 11:121007598-121007620 AAATAGAGCAGTAGAGAAGAGGG + Intergenic
1090292264 11:125555629-125555651 CTGTAAAGGAGCAGACAAGATGG - Intergenic
1090727038 11:129537589-129537611 CTGAGGAGAGGTGGAGAAGAAGG + Intergenic
1091096198 11:132824592-132824614 CAGTGGAGAAGCAGAGATGAAGG - Intronic
1091152386 11:133341007-133341029 CTGTGAAGAAGAAGAGAAGAAGG - Intronic
1091844022 12:3641448-3641470 CTGCAGAGCAGCAGAGGAGAGGG - Intronic
1091871358 12:3893824-3893846 GTGTAGAGAAGGAGAGAAACGGG - Intergenic
1092016630 12:5164609-5164631 CTGAAGAGAAGTATGGAAAAAGG - Intergenic
1092283900 12:7117667-7117689 CTGTTGAAAAGGAGAGCAGATGG + Intergenic
1093713004 12:22349292-22349314 CAGTAGAGATGAAGAAAAGAGGG + Intronic
1093819331 12:23593829-23593851 CTGGAAAGAGGTAGAGAAGAAGG + Intronic
1093905786 12:24690627-24690649 CTGGAGGGAAGCAGAGAGGATGG - Intergenic
1094307676 12:29038951-29038973 CTGTAGAGAAGTGGCTAAGATGG - Intergenic
1094357531 12:29594206-29594228 CTGTAGAAGAGTAGAGAAGGTGG - Intronic
1095544898 12:43354795-43354817 CTGGAGAAAAGTATAGAAGGTGG + Intronic
1095550615 12:43434582-43434604 ATGAAGAGATGTACAGAAGATGG + Intronic
1096585965 12:52619893-52619915 CTATACAGAAATAGAAAAGAAGG - Intergenic
1097413225 12:59281795-59281817 CTTTAGATAATCAGAGAAGAGGG - Intergenic
1098237513 12:68431718-68431740 CTGCAGAGAAGGAGAGAGGGAGG - Intergenic
1099341442 12:81440429-81440451 TTTTACAGAAGTAGAGAAAAAGG - Intronic
1099789774 12:87318640-87318662 CTGGAGTGAAGTGGAGAAGGGGG + Intergenic
1100723145 12:97380055-97380077 CTGTAGAGAAGAGGAAGAGAGGG - Intergenic
1101044291 12:100788619-100788641 TTGTACAGATGTAGAGAACATGG + Intronic
1101323955 12:103698284-103698306 CTGTGGGGAAGGAGAGGAGAAGG - Intronic
1101517568 12:105451138-105451160 CTGTATACATGTAGAGAGGAAGG - Intergenic
1102310418 12:111840647-111840669 CGGTAAAGGTGTAGAGAAGATGG - Intergenic
1102937371 12:116909164-116909186 CTGTAGAAAATTAGAGTATATGG - Intergenic
1103759857 12:123241060-123241082 TTGGAGAGAAGTAAAGAGGATGG - Intronic
1106603535 13:31207808-31207830 GTGGAGAGAAGTAGTGAGGAAGG - Intronic
1107013259 13:35688563-35688585 CTGTAAAGGAGCAGACAAGATGG - Intergenic
1107089458 13:36460952-36460974 TGGTAGAGATGTGGAGAAGAGGG - Intergenic
1108821013 13:54349736-54349758 CTGCAGAGAATTTGATAAGAAGG - Intergenic
1108941165 13:55955002-55955024 TTGTAGAGTAATAGAAAAGAGGG - Intergenic
1109056061 13:57550733-57550755 AAGTACAGAAGAAGAGAAGAGGG + Intergenic
1109253026 13:60043844-60043866 CTGTAGAGAAGAATAAAAGCAGG + Intronic
1109276898 13:60313557-60313579 CTGTAGATAAGAAGAGAAATTGG + Intergenic
1109668260 13:65567880-65567902 CTGTTGAGAAGAAGAGACAAAGG - Intergenic
1109885188 13:68532684-68532706 ATATAGAGATGTAGAGATGAAGG - Intergenic
1110260632 13:73481061-73481083 CTTTATTGAAGTACAGAAGAAGG - Intergenic
1110420731 13:75304787-75304809 ATGTAGAGAAGTAAGGAAGAAGG + Intronic
1110823267 13:79941580-79941602 ATGAAAAGAAGTAGAAAAGAAGG + Intergenic
1111501437 13:89126063-89126085 CTGTGGGGAAGCAGAGAGGAAGG + Intergenic
1111746528 13:92277244-92277266 TTTTTGAGAAGCAGAGAAGAAGG + Intronic
1112044887 13:95586822-95586844 CTGACGAGAAGTAGAGCTGATGG - Intronic
1113673205 13:112189010-112189032 CTGTAGACTAGGAGAGAGGAAGG + Intergenic
1113681329 13:112247158-112247180 CTCCAGAGAAGCAGAGAAGCAGG + Intergenic
1114200061 14:20511677-20511699 CTGTAGAGCAAGATAGAAGATGG + Intergenic
1114678938 14:24467121-24467143 CTGTAGAGAAGTGGGAAGGATGG - Intergenic
1114787270 14:25615344-25615366 AGGGAGAGAAGTAGAGAAGGAGG - Intergenic
1114890659 14:26918251-26918273 CTGCAGAGCAAAAGAGAAGAGGG - Intergenic
1114947975 14:27711056-27711078 CAGTAGAGATGGAAAGAAGAGGG - Intergenic
1115343165 14:32314021-32314043 CCGTAGAGAAGTAGAGCACAGGG - Intergenic
1115375240 14:32668043-32668065 CTGTAGAGGAATTTAGAAGATGG + Intronic
1115535435 14:34368720-34368742 CTGCAGAGAAGTAAAACAGATGG - Intronic
1115733959 14:36303201-36303223 CTGTATAGAAGTATAAAAGGTGG + Intronic
1116313578 14:43358537-43358559 ATATAGAGAAGTAGATAAAATGG - Intergenic
1116711846 14:48378214-48378236 TGGTAGTGAAGTAGGGAAGAGGG + Intergenic
1117275837 14:54192538-54192560 CTGTAAAGAAGAAGGGAAGCAGG + Intergenic
1117362160 14:54986545-54986567 CTAGAGAGTAGTAGAGAAAAAGG + Intronic
1117519258 14:56534072-56534094 ATGTATAAAAGTAGAGAAAAGGG + Intronic
1117685726 14:58250813-58250835 GATTAGAGAAGTAGAAAAGATGG + Intronic
1118341793 14:64900088-64900110 ATGTGGAGAAGTTGAGAGGAGGG - Intergenic
1118391116 14:65296455-65296477 CTGGAGAGCAGTTGAGAACAGGG - Intergenic
1118606690 14:67509190-67509212 CAGTAGGGAAGTAGACCAGATGG - Intronic
1118694674 14:68372607-68372629 CTGGAGAGAAACAGAAAAGAGGG + Intronic
1118788163 14:69064147-69064169 CTAGAGAGAATTAGGGAAGAGGG + Intronic
1118895519 14:69942561-69942583 CTGGAGATAAGGAGAGAAGCAGG - Intronic
1118979591 14:70705737-70705759 ATGAAGTGGAGTAGAGAAGAAGG - Intergenic
1119008547 14:70958542-70958564 CTGGCGAGAAGAAGAGAAGCAGG - Intronic
1119202518 14:72767097-72767119 CAGAAGCCAAGTAGAGAAGATGG + Intronic
1120545772 14:85809414-85809436 ATGTAGAGAGGTAGGGAATAGGG + Intergenic
1120862456 14:89267067-89267089 CTGTAGGGAAGAAGGGAAGAAGG - Intronic
1120874918 14:89367156-89367178 CTGTTGAAAATTAGGGAAGATGG - Intronic
1122015379 14:98790732-98790754 CTGTAGAGAAGCAAAGAACATGG + Intergenic
1122877074 14:104672757-104672779 ATGTAGAGAGACAGAGAAGAGGG - Intergenic
1123899458 15:24862280-24862302 CTGTCCAGAAGAACAGAAGAGGG + Intronic
1124161848 15:27277668-27277690 CTGTTGTGAAGCAGAGAATAAGG - Intronic
1124529812 15:30495818-30495840 GAGTAGAGACGTAGAGAAAATGG - Intergenic
1124912849 15:33939225-33939247 TTGTATAGAAGTGAAGAAGAGGG - Intronic
1125281754 15:38049069-38049091 CTATAGAGAAGAGGGGAAGAAGG - Intergenic
1126911440 15:53421332-53421354 ATGGAGAAAAGTGGAGAAGATGG - Intergenic
1126916421 15:53471443-53471465 CTGGACACAAATAGAGAAGACGG - Intergenic
1127376319 15:58388338-58388360 CTGTAGAGAAACAGAGCAGTAGG - Intronic
1127540963 15:59938638-59938660 CTGTAGAAAAGTAGAGGGAAGGG - Intergenic
1127595810 15:60480901-60480923 CTGAAGAGTAGTAGAGGAAAAGG + Intergenic
1127903065 15:63355279-63355301 CTGTATAGGAGCACAGAAGAGGG - Intronic
1128393302 15:67197946-67197968 ATGGATAGAAATAGAGAAGAGGG - Intergenic
1129185906 15:73906322-73906344 CTGGAGAGAACTATGGAAGAAGG + Intergenic
1130071365 15:80649129-80649151 CTGGAGCGATGCAGAGAAGATGG + Intergenic
1130797379 15:87224250-87224272 ATGTAGAGAAGTAAATAATAGGG + Intergenic
1131651971 15:94409932-94409954 CTGGAGAGAGGCAGAGTAGAGGG - Intronic
1133467092 16:6038011-6038033 CTGTAGGAAGTTAGAGAAGATGG + Intronic
1133997741 16:10761165-10761187 CTGTAGGGATGTAGGGATGATGG + Intronic
1135668611 16:24356156-24356178 CTTTAGAGAAGCAAAGAACAGGG + Intronic
1135693237 16:24562518-24562540 GTTTAGATAGGTAGAGAAGAGGG + Intronic
1136530243 16:30863279-30863301 TTGCTGAGAAGTAGTGAAGAGGG - Intronic
1137244626 16:46692504-46692526 CTGTATAGAAGCAGTGAACATGG + Exonic
1137630784 16:49942706-49942728 CTGGAGGGATGTAGAGAAAAGGG + Intergenic
1139020056 16:62737680-62737702 CTGTAGAAAATTAAAGCAGATGG - Intergenic
1139055328 16:63176438-63176460 GTTTAGAGAGGTTGAGAAGAAGG + Intergenic
1139536212 16:67575866-67575888 CTGTTGAGCAGTAGAGAAGTGGG + Intronic
1139696435 16:68678586-68678608 CTGTAGAGAAGGAGACAGGCTGG + Exonic
1140055045 16:71518354-71518376 CTGTAGAGCAATAGTGAAAAAGG - Intronic
1140225097 16:73070778-73070800 CTGGAGAGAGGCAGAGAGGATGG - Intergenic
1141055567 16:80810643-80810665 CTATAAAGAAGCAGAGAAGTGGG + Intergenic
1141328933 16:83090150-83090172 TTGGAGAGAAGTGGAGAAGCTGG - Intronic
1141813441 16:86392295-86392317 AGGGAGAGAAGTGGAGAAGATGG + Intergenic
1143032259 17:3974297-3974319 CTGTAGAGATGGAGGCAAGAGGG - Intergenic
1144192155 17:12856401-12856423 CTGTAGGGAAGCAGAGAAGAAGG - Intronic
1145793723 17:27643809-27643831 TTGGAGAGACGTAAAGAAGAGGG - Intronic
1146008282 17:29176112-29176134 CTGGAGAGTAGGGGAGAAGAAGG + Intronic
1146922693 17:36723746-36723768 CTGTACAGGAGAACAGAAGAAGG - Intergenic
1147131898 17:38414792-38414814 CTGTAGGGAAAAAGAGAGGAGGG + Intergenic
1147250110 17:39148096-39148118 CTGGGGAGAGCTAGAGAAGATGG + Intronic
1148071762 17:44912626-44912648 CTGTGGACAGGAAGAGAAGAAGG - Intronic
1148848960 17:50545241-50545263 ATGCAGAGGAGCAGAGAAGAGGG - Intronic
1149869253 17:60168069-60168091 ATGTAGAGATGTAGAGATGTAGG + Intronic
1150213454 17:63454116-63454138 GTGCAGAGAAGGAGAGAAGTGGG - Intergenic
1150751372 17:67865853-67865875 TTGTCCAGAAGTAAAGAAGAGGG + Intronic
1151186870 17:72371209-72371231 CTGGAGAGAAGGGGAGAAGGGGG - Intergenic
1153766291 18:8378213-8378235 CTTTAGAGAACCAGAGAAGGAGG - Intronic
1153936090 18:9924224-9924246 ATGTAAAGAAATAGAAAAGAAGG - Intronic
1156590005 18:38476096-38476118 CTGTATGGAGGTAGAGAAGATGG + Intergenic
1156838275 18:41581743-41581765 ATGTAGGGAAGAAGAAAAGAAGG - Intergenic
1157030751 18:43904721-43904743 CTGTAGTCAAGTAGAGATGAGGG + Intergenic
1158064085 18:53384762-53384784 CTATAGAAAAGTACAGAAAATGG - Intronic
1158102240 18:53842389-53842411 CAGCAGAGACGTGGAGAAGAGGG + Intergenic
1159064908 18:63559062-63559084 AAGGAGAGAAGGAGAGAAGAAGG - Intronic
1159174169 18:64812964-64812986 CTGTAAAGGAGCAGACAAGATGG + Intergenic
1161830742 19:6602409-6602431 CTGTAAAGGAGCAGACAAGATGG + Intronic
1164235331 19:23327038-23327060 CTCTAAATAAGTAGAGAAAACGG - Intronic
1164292514 19:23880729-23880751 AGGAAGAGAATTAGAGAAGAAGG + Intergenic
1166316168 19:41991447-41991469 CTGTAGGGCAGTAGGAAAGATGG - Intronic
1166709801 19:44929405-44929427 CTGTGGGGAAGTAAAGCAGAAGG + Intergenic
1166974828 19:46599952-46599974 CAGTGGAGAGGTAAAGAAGATGG - Intronic
1168323954 19:55528708-55528730 CCGGAGAGAAGGAGAGAGGACGG + Intergenic
926201448 2:10802367-10802389 TTTAAAAGAAGTAGAGAAGAGGG - Intronic
928681970 2:33711953-33711975 CTGTAGAGAAGAGGAAATGAAGG - Intergenic
930245802 2:48982247-48982269 GTGTAGGTAAGAAGAGAAGATGG + Intronic
930251441 2:49038892-49038914 CAATAGAGAAGGAGAAAAGAAGG + Intronic
930715357 2:54588717-54588739 CTGTAGAGATGGAGAGTAGCAGG + Intronic
930905719 2:56564524-56564546 CTATAAAGACATAGAGAAGATGG - Intergenic
931009185 2:57888389-57888411 TTGTAGAGAAGTACTGAAGCTGG - Intergenic
931061005 2:58529933-58529955 ATGAAGAGATGAAGAGAAGAAGG + Intergenic
932052496 2:68412693-68412715 CTGTAGTGAAGGAGAGCAGAGGG - Intergenic
932703623 2:74006835-74006857 CTGTAGAGACGCTGAGAACAAGG - Intronic
932809768 2:74815044-74815066 CTGTAGAGAGGGAGAAAAGCGGG - Intergenic
932921741 2:75923733-75923755 CTGAATAGAAGGAGAGGAGAGGG + Intergenic
933184598 2:79264966-79264988 CTGTACAGAAGCAGAGCAGATGG - Intronic
933448298 2:82411379-82411401 CTGAAGAGAAGGAGAGAAAAGGG - Intergenic
933803782 2:85983344-85983366 CTGTAAAGAAGGAGTGAAGCTGG - Intergenic
934615361 2:95767401-95767423 CTGGAGAGTAGGAGAGGAGAGGG - Intergenic
935880469 2:107559775-107559797 CTGTAAAGGAGCAGACAAGATGG + Intergenic
937479963 2:122247718-122247740 CTATAGAGAAATAGAGATAAAGG - Intergenic
937714975 2:125021902-125021924 CTGGAGAGAAGAAGAAAACAGGG + Intergenic
939256140 2:139747011-139747033 CGGAAGAGAAAGAGAGAAGAGGG + Intergenic
939519730 2:143214611-143214633 CTGTAGAGTTGTGGAGAACATGG + Intronic
939759497 2:146156444-146156466 CTGTAGGAAAGTAGATATGATGG + Intergenic
940388865 2:153107599-153107621 CTGGAGAGGAGTAGAGAAGTAGG + Intergenic
940701738 2:157053215-157053237 CTGAAGAGCTGGAGAGAAGAGGG + Intergenic
941841138 2:170085992-170086014 GAGAAGAGAAGTAGAGTAGAAGG + Intergenic
942568210 2:177287658-177287680 CTGTGATGAAGTAGAGCAGAGGG - Intronic
942898411 2:181086033-181086055 CTGTAGAGGAATAGAGAGGATGG + Intergenic
943154973 2:184164517-184164539 GGGTAGAGAAGTTGAGAGGAGGG - Intergenic
943748535 2:191487357-191487379 CTATATACAAGTTGAGAAGATGG - Intergenic
943974609 2:194457895-194457917 CTGTAGAGCAGTGGAGAACAAGG + Intergenic
944439966 2:199732178-199732200 GATTAGAGAAGTAGAAAAGAAGG - Intergenic
946236548 2:218327752-218327774 CAGTAGAGATGTAGGGAGGAAGG - Intronic
946522303 2:220479714-220479736 CTGTGGAGAGGTAAGGAAGAAGG - Intergenic
947174419 2:227348752-227348774 CTGTTGAGAAATAGAGAGGAAGG + Intronic
948274731 2:236699670-236699692 CTGGAGAGATGGTGAGAAGATGG + Intergenic
1170624617 20:18021766-18021788 TGGGAGAGAAGGAGAGAAGAAGG + Intronic
1171077179 20:22139732-22139754 TTGCAGAGATGTAGAGAAGTTGG - Intergenic
1171385314 20:24765862-24765884 CTGTTGACAAGCAGAGAAGTAGG + Intergenic
1172670536 20:36632017-36632039 CTGCTTAGAAGTAGAGGAGATGG - Intronic
1173242793 20:41312719-41312741 CTGTACAGAAGAGGAGAATACGG + Intronic
1173315161 20:41936591-41936613 TTTTAGAGAAGTAGAGAGGTAGG + Intergenic
1174747554 20:53078709-53078731 CAATAGAGATGTAGAGAAGTGGG + Intronic
1174797693 20:53536157-53536179 CTGCAGAGAAGGACGGAAGAAGG - Intergenic
1176165056 20:63668466-63668488 CTGAAGGGAAATAGAGCAGAGGG + Intronic
1177351077 21:19942392-19942414 ATGTAGAAAATTAGAGAAAAGGG + Intergenic
1178948729 21:36968531-36968553 CTGTAGAGAAGTGTAGGATATGG - Intronic
1182426949 22:30278600-30278622 GGGTAGAGAAGTAGACAAGAGGG + Intergenic
1182651316 22:31853418-31853440 CTGAATAGAGGTAGAGTAGAGGG + Intronic
1184932575 22:47692105-47692127 CTGTATAGTAATACAGAAGAGGG + Intergenic
951263369 3:20538965-20538987 CTGTAGTGAAGTAAAGAAGTTGG - Intergenic
951402651 3:22252651-22252673 CGATAGAGAAGCAGAGAAGCTGG + Intronic
951615584 3:24539996-24540018 CTGAAGAAAAGGAGGGAAGAGGG - Intergenic
953401604 3:42626132-42626154 GTGTAAAGTAGTACAGAAGAGGG - Intronic
954002194 3:47566509-47566531 GTGGAGAGAATTAGAGATGAAGG + Intronic
954004528 3:47580201-47580223 CTGTAGATAAGATGAGATGATGG - Exonic
954225305 3:49177338-49177360 CTGTAGAGAGGAAGATTAGAGGG - Intergenic
954984741 3:54779696-54779718 CAGTAGAGAAGCAGAGCAGCAGG - Intronic
955075158 3:55606823-55606845 CTGTAAAGAAGAAGAGGAGGAGG - Intronic
956055490 3:65294311-65294333 ATGGAAGGAAGTAGAGAAGAGGG - Intergenic
956113313 3:65893179-65893201 CAGTAGAGAAGAAGGGATGAAGG - Intronic
957036203 3:75295393-75295415 TTGTAGAGATGTGGAAAAGACGG - Intergenic
957296333 3:78337547-78337569 GAGAAGAGAAGTAGAGAAAAGGG + Intergenic
957595633 3:82261745-82261767 ATGATGAGAAATAGAGAAGAGGG - Intergenic
958441137 3:94157543-94157565 TTGTAGAGAAGAAGAGCAAATGG + Intergenic
958528913 3:95298861-95298883 CAGTAGAAGAGTACAGAAGAGGG + Intergenic
959010994 3:101076189-101076211 CTGTTGGAAAGTAGAAAAGAAGG - Intergenic
959280049 3:104325837-104325859 CTGTAAAGGAGTAGACAAGATGG + Intergenic
959476449 3:106818106-106818128 CTGTAGAGAAGTAGGGGAGAAGG + Intergenic
959523084 3:107342839-107342861 CTGAAGAGAAGTTAAGAGGAGGG + Intergenic
959635203 3:108559053-108559075 CTGTAGAGTATCTGAGAAGAGGG + Intronic
959721329 3:109492951-109492973 CAGTGGAGAAGTAGATGAGATGG + Intergenic
960604291 3:119489161-119489183 CTGTAGAGAAGAATGGAACATGG + Intronic
960686488 3:120299626-120299648 TTAGAGAGAAGTAGAGTAGAGGG - Intergenic
960780979 3:121316340-121316362 CAGTACAGAAATAGAAAAGATGG + Intronic
962842804 3:139251276-139251298 AAATAGAGAAGCAGAGAAGAGGG - Intronic
962865917 3:139447991-139448013 GGGTAGAGGAGGAGAGAAGATGG - Intergenic
963025685 3:140916680-140916702 GAGAAGAGAAGAAGAGAAGAGGG - Intergenic
964148659 3:153497427-153497449 ATGTTTAGAAGTAGAGATGATGG + Intronic
964235761 3:154524982-154525004 CAGTAGAGAAATAGAAAAGTTGG - Intergenic
964422575 3:156519704-156519726 GTAGAGAGAAATAGAGAAGATGG - Intronic
964749686 3:160042808-160042830 CTGGAGTGAAGTAGTGCAGATGG - Intergenic
965698564 3:171436151-171436173 CTGTATAGGAGTGGGGAAGATGG - Intronic
965992821 3:174841150-174841172 CTGTAGAGAATCTGAGAAAAAGG - Intronic
966043226 3:175518013-175518035 CTGGAAAGGAGGAGAGAAGATGG + Intronic
969648222 4:8446453-8446475 CTGGAAAGAAAAAGAGAAGAAGG - Intronic
969864372 4:10064206-10064228 TTATAGAGCAGTGGAGAAGAAGG - Intergenic
970463817 4:16303643-16303665 CTGTATATAAGAAGTGAAGATGG - Intergenic
970663819 4:18314795-18314817 ATGTAGTGAAGTAGAGAGGGAGG - Intergenic
973171825 4:47154839-47154861 CTGTAGAGAAAGAAAGAAAATGG - Intronic
974500808 4:62699392-62699414 CTGAAGAGAAGTGGAGAGGGAGG + Intergenic
975025792 4:69547043-69547065 CATTTGAGAAGTAGGGAAGAAGG - Intergenic
975316175 4:72955804-72955826 CTGTAGAACAGATGAGAAGAAGG - Intergenic
975589475 4:75986034-75986056 CTGTAGAGAAGGAAAGCACAGGG - Intronic
976046095 4:80949900-80949922 GTGTAGAGCAGTACAGACGAGGG + Intronic
976103325 4:81589129-81589151 CTGAAGACAAGTAGTGAAAATGG + Intronic
976289753 4:83405344-83405366 TTCTAGAGAAGTAGATAAGTGGG - Intergenic
977138427 4:93336162-93336184 CTGTAAAGAAAGAGAGGAGAAGG - Intronic
977147357 4:93460520-93460542 ATGTTGAGGAGTATAGAAGATGG - Intronic
977850329 4:101819912-101819934 TTGTAGAAAAGAAGAGGAGAAGG + Intronic
978582568 4:110246932-110246954 CTGTAGAGAAGTATAAAGAAGGG + Intergenic
978885952 4:113766601-113766623 CAGTAGAGAATTGGAGAACATGG + Intergenic
979612177 4:122700797-122700819 CTTTACAGCAGTGGAGAAGAGGG + Intergenic
980320768 4:131271502-131271524 CTGAAGACAAGCAGAGAAAATGG - Intergenic
980535607 4:134117436-134117458 CTCTAGAAAATTGGAGAAGATGG - Intergenic
982460201 4:155660448-155660470 TTGTAGAAAAGGAGGGAAGAAGG - Intergenic
982916308 4:161213960-161213982 GTGTAGGGAAGTAGATAAGAAGG + Intergenic
985142561 4:186857283-186857305 TTGTAGAGGAGTGGAGACGATGG + Intergenic
985900295 5:2783439-2783461 CAGAAGAGAAGGGGAGAAGACGG - Intergenic
987206107 5:15627684-15627706 CTATAGAAGAGTTGAGAAGATGG - Intronic
987368409 5:17170938-17170960 CTGTACAGGAATAGACAAGACGG - Intronic
988346416 5:30042655-30042677 GTGAAGAGAAGGAGAGAAGAGGG + Intergenic
989541421 5:42623247-42623269 CTGTTGAGAAGTTGAGTACAAGG + Intronic
989753336 5:44922073-44922095 CTGTTGGGAACTAGAGTAGATGG + Intergenic
990115582 5:52386311-52386333 CTTCACAGAAGTAGAGTAGAGGG + Intergenic
990602080 5:57369253-57369275 CTGTAGAGTGGGAGAGAAGGGGG + Intergenic
990805458 5:59655669-59655691 CTGTTGATAAGTGGAAAAGAGGG + Intronic
991036185 5:62130354-62130376 CTATAGACAACTAGAGAGGAAGG + Intergenic
991228144 5:64296838-64296860 TTCAAGAGAAGTAGAGAAAATGG - Intronic
991249648 5:64545530-64545552 CTGTAGAGAATAAGTGAAAAGGG + Intronic
991500893 5:67276149-67276171 CTGTATAAAAGTTGAGAAAATGG - Intergenic
991922000 5:71666265-71666287 CTGAAGAGAAGGAGAGAATGGGG - Intergenic
991951955 5:71955001-71955023 AGGGAGAAAAGTAGAGAAGAAGG + Intergenic
992416411 5:76556300-76556322 CTGTAAAGGAGCAGACAAGATGG - Intronic
992936270 5:81709440-81709462 CTGCATATAGGTAGAGAAGATGG - Intronic
994073035 5:95621761-95621783 CTGTAGGGAAGAAGAGAAACTGG - Exonic
994352668 5:98764836-98764858 ATGAAGAGAGGGAGAGAAGAGGG + Intergenic
994419086 5:99509923-99509945 CTGTTGAGAAATAGAGCAGACGG + Intergenic
994646984 5:102482668-102482690 CAGTAAAGAAGTATAGCAGAAGG - Intronic
994681626 5:102894880-102894902 CAGTAGAGAAGGAGAAAAGAGGG - Intronic
996037331 5:118772686-118772708 ATTTAAAGAAGTAGAGAAGTTGG + Intergenic
996477583 5:123938464-123938486 CTGTAAAGGAGCAGACAAGATGG - Intergenic
996551273 5:124732942-124732964 CTGTATAGAGGGAGGGAAGAAGG - Intronic
996709845 5:126533589-126533611 CTGTACAGAAGTGTAGAAGAAGG - Intergenic
996857579 5:128027025-128027047 TGATAGAGGAGTAGAGAAGACGG + Intergenic
997202254 5:132018052-132018074 CAGTACAGAGGGAGAGAAGAGGG + Intergenic
998385511 5:141754982-141755004 ATGCAGAGAAGTGGAGCAGATGG + Intergenic
1000043514 5:157502796-157502818 CTGTGGAGAAGAAGAGGTGAGGG - Exonic
1000518282 5:162267591-162267613 CTTTACAGAAGTAAAGTAGAGGG + Intergenic
1001875175 5:175194173-175194195 ATGTAAAGAAGCACAGAAGACGG + Intergenic
1002079458 5:176728735-176728757 CTGTCGGGATGGAGAGAAGAAGG + Intergenic
1002586657 5:180252959-180252981 ATGTGGAGAAGTAGAGCTGAGGG + Intronic
1003870525 6:10399131-10399153 CTCTAGAGGAGCAGGGAAGAGGG - Intronic
1004954840 6:20717884-20717906 CAGTAGAGAAGGAGAAAGGATGG + Intronic
1005252150 6:23959542-23959564 CTGTTGACAAGTAGAGAAGATGG - Intergenic
1005332614 6:24764410-24764432 CTGTGGAGAAGGAGGTAAGAGGG - Intergenic
1005356988 6:24994571-24994593 CTGTAGAAGAGCAAAGAAGAAGG + Intronic
1006189132 6:32196876-32196898 CTATAGAGAAGTTGAGCAGATGG - Intronic
1006390678 6:33756439-33756461 GGGGAGAGAGGTAGAGAAGAGGG + Intergenic
1006535120 6:34693330-34693352 CTTTAGAGAAATTGAGAAGTTGG - Intronic
1006843440 6:37046794-37046816 GTGAAGAGAAAGAGAGAAGACGG + Intergenic
1007013588 6:38441006-38441028 CTGTGGAGAAGTGGAGAAGCTGG + Intronic
1007680192 6:43628703-43628725 CAGGAGAGAAGTAGAGAAAGGGG - Intronic
1007769498 6:44181211-44181233 CAGCAGAGAAGGAGTGAAGAAGG - Intronic
1009413586 6:63393478-63393500 CTGTACAGAAGAAGGGAAGATGG - Intergenic
1010867407 6:80996069-80996091 CTGGTGAGATGTAGAGAAAAGGG - Intergenic
1011505966 6:88044457-88044479 CGGTAGAGAAGTAGTGAAATGGG + Intergenic
1011648035 6:89478841-89478863 GTGAAGAGACATAGAGAAGATGG + Intronic
1012449386 6:99339065-99339087 CTGTAGAGAAGAGGGGAAGGGGG - Intronic
1012513880 6:100036140-100036162 CTGAAGAGAAGTAGAAAAAGAGG + Intergenic
1012700766 6:102453817-102453839 CTGTAGATAACTACAGAAAAAGG - Intergenic
1013802140 6:113959266-113959288 ATGTAGACATTTAGAGAAGAGGG - Intronic
1013956722 6:115850837-115850859 CTGTAGAGAATAAGACTAGATGG + Intergenic
1013979444 6:116112334-116112356 ATGTAGAGAAGTATGGAAGAAGG + Intronic
1014072578 6:117200299-117200321 TTGTAGAGAAAGAGAGAAGAGGG - Intergenic
1014544176 6:122713779-122713801 ATGTAAAGAGGTAGAGAAAAAGG + Intronic
1015573494 6:134646369-134646391 CTGCAGTGTAGCAGAGAAGAAGG - Intergenic
1016117389 6:140303776-140303798 CTGCAGAGAAGGAGAGCAGAGGG - Intergenic
1016471548 6:144379907-144379929 CTGTGGAGGAGTGGAGGAGAAGG + Intronic
1016827027 6:148397938-148397960 CTGTGCAGGAGTACAGAAGAGGG + Intronic
1017201119 6:151755952-151755974 CTGAATGGAAGTGGAGAAGATGG - Intronic
1018067708 6:160135111-160135133 CAGCAGAGAGGAAGAGAAGAGGG - Intronic
1018971091 6:168529804-168529826 ATGCAGAGAAGCAGAGAAGCGGG + Intronic
1019162325 6:170076858-170076880 CTGTGGGGAAGAAGAGAGGAGGG - Intergenic
1019297956 7:289231-289253 CTGGAGAAAAGTAGAGAGGCGGG - Intergenic
1019875642 7:3808240-3808262 TTGTAGAGAAGAAGAGTTGACGG + Intronic
1021409144 7:20308735-20308757 ATGTAGACAAGTATAGAAGTTGG - Intergenic
1021667400 7:22998649-22998671 CTGTGGAGATGGAGAGCAGATGG - Intronic
1022437343 7:30401878-30401900 GTGGGGAGAAGAAGAGAAGAGGG - Intronic
1022468500 7:30667040-30667062 CTGTAGGGGAGTAGAGAAGGGGG - Intronic
1022636670 7:32142648-32142670 CAGGAGAGAAAAAGAGAAGATGG - Intronic
1022963861 7:35455082-35455104 CTGAAGAGAAGTCGCGGAGAGGG - Intergenic
1023591339 7:41783635-41783657 CTGTAGATGTGGAGAGAAGACGG + Intergenic
1024080906 7:45854085-45854107 CTGTCGGGAAGGGGAGAAGAGGG + Intergenic
1024317784 7:48036976-48036998 CTGTAGGAGGGTAGAGAAGAGGG + Intronic
1024382237 7:48710596-48710618 TTGTAGAGAAATAGAAAAAAAGG - Intergenic
1024432109 7:49300993-49301015 CTGTAGAGGAGCAGACAAGATGG - Intergenic
1024687803 7:51766444-51766466 GTTTAGAGGTGTAGAGAAGAAGG - Intergenic
1024994354 7:55260946-55260968 CAGCAGAGAAATAGAAAAGAGGG + Intergenic
1025123599 7:56327754-56327776 CTGTCGGGAAGGGGAGAAGAGGG - Intergenic
1026306382 7:69145869-69145891 CAGTAGATAATTAGAGGAGAGGG - Intergenic
1026518418 7:71093515-71093537 GTGAAGTGGAGTAGAGAAGACGG + Intergenic
1026561451 7:71453803-71453825 GTGCAGAGAAGGAGAGAAGGTGG - Intronic
1026958666 7:74394623-74394645 CTGTATAGAAGGAAAGGAGATGG - Intronic
1027889615 7:83954077-83954099 CTGTATGGAAATAGAGAAAAAGG - Intergenic
1029950051 7:104574399-104574421 TTTTAGAGAAGTAGAATAGAGGG + Intronic
1030198184 7:106874225-106874247 CTGTAGAGAAGTAGAGAAGATGG - Intronic
1030924223 7:115431275-115431297 GTGAAGACAAGAAGAGAAGATGG + Intergenic
1031070541 7:117156588-117156610 ATGTGGAGAGATAGAGAAGAGGG + Intronic
1031564770 7:123281988-123282010 CTATAGAGAAGAGGAGTAGATGG - Intergenic
1031859315 7:126959336-126959358 CATTAGAGAAGTAGAAGAGAGGG + Intronic
1032106756 7:129038105-129038127 CTGAAGGGAAGCAGAGAAAAAGG + Intronic
1032493205 7:132340557-132340579 ATGGAGAGAAGCAGAAAAGAGGG + Intronic
1032517566 7:132518526-132518548 CTGGAGAAAAGTATAAAAGATGG + Intronic
1032584413 7:133132945-133132967 CTGTAAATAAGCAAAGAAGAAGG + Intergenic
1033068286 7:138177225-138177247 GAGAAGAGAAGAAGAGAAGAGGG + Intergenic
1033164335 7:139026535-139026557 CTTGCGAGAAGTAAAGAAGATGG - Exonic
1033190460 7:139274324-139274346 TAGTAGAGAAAAAGAGAAGAGGG + Intronic
1033845932 7:145432151-145432173 CTGAGGAGAAGGAGAGATGAGGG + Intergenic
1034238538 7:149591854-149591876 CTCTAGAGAAGGAGTGAAGCTGG + Intergenic
1035723157 8:1807970-1807992 CTGTAGAGGAGTGAAAAAGAAGG + Intergenic
1037121538 8:15293543-15293565 CTGTGGAAAACTAGAAAAGAGGG + Intergenic
1037192829 8:16148147-16148169 CTGTATGGAAGTAGAGAGTAAGG - Intronic
1037373396 8:18203951-18203973 CTGTAAAGGAGCAGACAAGATGG + Intronic
1037456185 8:19066566-19066588 CTGTGGAGTAGAAGAGAAGTTGG - Intronic
1037725765 8:21481399-21481421 AAGTAGAGAAGGAAAGAAGAGGG + Intergenic
1037836883 8:22219871-22219893 GTGTGGAGAAGGAGAGAACATGG - Exonic
1038538698 8:28373350-28373372 CTATAGAGAGATAGAGATGAAGG + Intronic
1040525906 8:48225174-48225196 CTGTAAAGGAGCAGAGAAGGTGG + Intergenic
1040528346 8:48244106-48244128 CTGTAAAGGAGCAGACAAGATGG + Intergenic
1042895973 8:73668159-73668181 CTGTAGACTTGTAGTGAAGAAGG - Intronic
1042938692 8:74086271-74086293 TTGTAGAGAAAGACAGAAGATGG - Intergenic
1044054539 8:87552393-87552415 CTGTAGATAAGTAGAACAAAGGG + Intronic
1044599404 8:93988713-93988735 ATGTAGAGAAGTAGTGAGCATGG + Intergenic
1045714239 8:105022779-105022801 CTGGAGGGAAGGAGAGACGAAGG - Intronic
1046347562 8:112953106-112953128 GTGTAGACAAATTGAGAAGAGGG + Intronic
1047429568 8:124779423-124779445 CTGGAGAGCAGTAGAGATCACGG + Intergenic
1048039717 8:130714772-130714794 ATGTTGAGTAGTAGAGGAGATGG + Intergenic
1048150521 8:131889134-131889156 CAGTAGATAAGTAAAGCAGATGG + Intergenic
1048170332 8:132100105-132100127 CCTTAGAGAAGAAGAGAGGAAGG - Exonic
1048709047 8:137187487-137187509 CTGGAGAGAAGTAGGGGAAAGGG + Intergenic
1048776535 8:137952931-137952953 CATTAGAGAACTAGAGAAGAGGG - Intergenic
1050867863 9:10526764-10526786 CAGTAGTGCAGTAGAGAAGAAGG + Intronic
1051491956 9:17676238-17676260 TTGTAGAAAAGTTGAGGAGAAGG - Intronic
1052400836 9:27998180-27998202 ATGTAGAGAAATGGAGAATATGG + Intronic
1053191175 9:36070547-36070569 CTTTAGGGAACTAGAAAAGAAGG + Intronic
1053365999 9:37522980-37523002 ATGGAGAGAAGCAGAAAAGAAGG + Intronic
1054352416 9:64029214-64029236 AGGGAGAGAAGTAGGGAAGAAGG + Intergenic
1055031376 9:71773907-71773929 CTGTAGGGAAGTAGGCAGGATGG - Intronic
1055865850 9:80812263-80812285 CTGAAGAGAAGAAGAGTTGAAGG + Intergenic
1057320953 9:94012041-94012063 GTGGAGAGCAGTATAGAAGATGG + Intergenic
1057404146 9:94752718-94752740 CTGTAGAAAAGCATGGAAGATGG - Intronic
1058212254 9:102183790-102183812 ATGTAGAGAGGAAGAGAAGAAGG - Intergenic
1059711494 9:116871878-116871900 GTGTAGAACAGTAGATAAGAGGG + Intronic
1059726612 9:117014567-117014589 CCATAGAGAAGAATAGAAGAAGG - Intronic
1059729645 9:117044253-117044275 GTGTAGAGAAGGACATAAGAAGG + Intronic
1060092373 9:120754602-120754624 CTTTGGAGAGGTAGAGAAAAGGG - Intronic
1060683095 9:125583227-125583249 ATGTAGAGAGGTTGAGAGGAGGG - Intronic
1060771384 9:126334649-126334671 CTGTAGAGAAGGAGAAAAAAAGG - Intronic
1061604933 9:131702139-131702161 CTCTACAGAAGCAGCGAAGAGGG + Intronic
1061650148 9:132041055-132041077 CAGCAGAGAAGAAGAGCAGAAGG + Intronic
1062257025 9:135630834-135630856 CTGTAGACAAGAAGATAAAATGG + Intronic
1185936159 X:4258662-4258684 ATGTAGAGAAGGAGAGCTGATGG - Intergenic
1186461579 X:9752598-9752620 CTGCAGAGAACCAGAGAGGAGGG + Intronic
1186503219 X:10068703-10068725 CTGCAGAGATGGAGATAAGATGG - Intronic
1186720266 X:12296631-12296653 CTGCTGTGAAGTAGAGATGAAGG - Intronic
1187081539 X:15994487-15994509 GTGTAGAGAACAAGATAAGAGGG - Intergenic
1187567035 X:20461021-20461043 CTGTAGAGATGGAGAACAGATGG - Intergenic
1187572466 X:20518943-20518965 CTGAAGTGAACTGGAGAAGAGGG + Intergenic
1187985272 X:24803279-24803301 CTGGAGAGAAGGAGAGCACACGG + Intronic
1188955153 X:36425325-36425347 CTATAGAGAAGTTGAAATGAAGG + Intergenic
1189497478 X:41522109-41522131 CTTTAGAGAAGAGGAGAGGAGGG - Intronic
1191148906 X:57199157-57199179 TTGTAAAGAAGTACAAAAGAAGG - Intergenic
1192463602 X:71339246-71339268 ATATAGAGAAGGAAAGAAGAAGG - Intergenic
1193150456 X:78118983-78119005 GGGTAGAGAAGGATAGAAGATGG + Intronic
1194693076 X:97010392-97010414 CTGAAAAGAAGCAGTGAAGAAGG - Intronic
1195760955 X:108245921-108245943 CTGTATAGAAGTGGCCAAGAGGG + Intronic
1195961096 X:110387708-110387730 CCGTTGAGAAGTAGAGAACATGG - Intronic
1196680314 X:118463485-118463507 TTGAAGAGAAGAAAAGAAGAGGG - Intergenic
1196987837 X:121294566-121294588 CTAAAGAAAAGTAGAAAAGAAGG - Intergenic
1197329895 X:125140939-125140961 CTCTAGAGAAGAAGGGAAGGAGG - Intergenic
1197408598 X:126087497-126087519 CTGTACAGAACTAAAGAAAACGG + Intergenic
1198405061 X:136304127-136304149 CTGTAGATATGGAGAGCAGATGG + Exonic
1199158203 X:144574586-144574608 CTGTAGATAAGCAGAAGAGAAGG - Intergenic
1201629291 Y:16051866-16051888 CTGCAGATAATTAGAGAAAATGG - Intergenic