ID: 1030204505

View in Genome Browser
Species Human (GRCh38)
Location 7:106939855-106939877
Sequence CTTTTCATTGTTCTTTCTTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030204505_1030204506 -8 Left 1030204505 7:106939855-106939877 CCAAAAGAAAGAACAATGAAAAG No data
Right 1030204506 7:106939870-106939892 ATGAAAAGCCAGAAAAGCAGAGG No data
1030204505_1030204509 24 Left 1030204505 7:106939855-106939877 CCAAAAGAAAGAACAATGAAAAG No data
Right 1030204509 7:106939902-106939924 AAATACACCAGAGAGTCTCTTGG No data
1030204505_1030204508 0 Left 1030204505 7:106939855-106939877 CCAAAAGAAAGAACAATGAAAAG No data
Right 1030204508 7:106939878-106939900 CCAGAAAAGCAGAGGAAGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030204505 Original CRISPR CTTTTCATTGTTCTTTCTTT TGG (reversed) Intergenic
No off target data available for this crispr