ID: 1030204508

View in Genome Browser
Species Human (GRCh38)
Location 7:106939878-106939900
Sequence CCAGAAAAGCAGAGGAAGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030204505_1030204508 0 Left 1030204505 7:106939855-106939877 CCAAAAGAAAGAACAATGAAAAG No data
Right 1030204508 7:106939878-106939900 CCAGAAAAGCAGAGGAAGCTTGG No data
1030204504_1030204508 3 Left 1030204504 7:106939852-106939874 CCTCCAAAAGAAAGAACAATGAA No data
Right 1030204508 7:106939878-106939900 CCAGAAAAGCAGAGGAAGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030204508 Original CRISPR CCAGAAAAGCAGAGGAAGCT TGG Intergenic
No off target data available for this crispr