ID: 1030206300

View in Genome Browser
Species Human (GRCh38)
Location 7:106955368-106955390
Sequence CTCATATGACAGAAGGGGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030206300_1030206305 3 Left 1030206300 7:106955368-106955390 CCTTGCCCCTTCTGTCATATGAG No data
Right 1030206305 7:106955394-106955416 ACAGCAAGAAAGTGCCATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030206300 Original CRISPR CTCATATGACAGAAGGGGCA AGG (reversed) Intergenic
No off target data available for this crispr