ID: 1030206305

View in Genome Browser
Species Human (GRCh38)
Location 7:106955394-106955416
Sequence ACAGCAAGAAAGTGCCATCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030206304_1030206305 -4 Left 1030206304 7:106955375-106955397 CCTTCTGTCATATGAGGACACAG No data
Right 1030206305 7:106955394-106955416 ACAGCAAGAAAGTGCCATCTTGG No data
1030206303_1030206305 -3 Left 1030206303 7:106955374-106955396 CCCTTCTGTCATATGAGGACACA 0: 3
1: 35
2: 279
3: 746
4: 1671
Right 1030206305 7:106955394-106955416 ACAGCAAGAAAGTGCCATCTTGG No data
1030206302_1030206305 -2 Left 1030206302 7:106955373-106955395 CCCCTTCTGTCATATGAGGACAC 0: 2
1: 21
2: 157
3: 502
4: 1296
Right 1030206305 7:106955394-106955416 ACAGCAAGAAAGTGCCATCTTGG No data
1030206299_1030206305 4 Left 1030206299 7:106955367-106955389 CCCTTGCCCCTTCTGTCATATGA No data
Right 1030206305 7:106955394-106955416 ACAGCAAGAAAGTGCCATCTTGG No data
1030206300_1030206305 3 Left 1030206300 7:106955368-106955390 CCTTGCCCCTTCTGTCATATGAG No data
Right 1030206305 7:106955394-106955416 ACAGCAAGAAAGTGCCATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030206305 Original CRISPR ACAGCAAGAAAGTGCCATCT TGG Intergenic
No off target data available for this crispr