ID: 1030206895

View in Genome Browser
Species Human (GRCh38)
Location 7:106959941-106959963
Sequence GCCACTCTAGAGGCTGGAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030206895_1030206899 11 Left 1030206895 7:106959941-106959963 CCAGCTCCAGCCTCTAGAGTGGC No data
Right 1030206899 7:106959975-106959997 GCACCAGTGCGGTGTGCCTTAGG No data
1030206895_1030206898 0 Left 1030206895 7:106959941-106959963 CCAGCTCCAGCCTCTAGAGTGGC No data
Right 1030206898 7:106959964-106959986 AGCTGCTGTGAGCACCAGTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030206895 Original CRISPR GCCACTCTAGAGGCTGGAGC TGG (reversed) Intergenic
No off target data available for this crispr