ID: 1030207785

View in Genome Browser
Species Human (GRCh38)
Location 7:106967273-106967295
Sequence TCTCCAGGACCACAGAAAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030207780_1030207785 9 Left 1030207780 7:106967241-106967263 CCTGAGCAAGGGAGTGCGGATGG No data
Right 1030207785 7:106967273-106967295 TCTCCAGGACCACAGAAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030207785 Original CRISPR TCTCCAGGACCACAGAAAAG AGG Intergenic
No off target data available for this crispr