ID: 1030214883

View in Genome Browser
Species Human (GRCh38)
Location 7:107034363-107034385
Sequence TTTGATTAAGTTGAGGAGTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030214883_1030214885 11 Left 1030214883 7:107034363-107034385 CCATACTCCTCAACTTAATCAAA No data
Right 1030214885 7:107034397-107034419 ATATCATTCCCATTTCTCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030214883 Original CRISPR TTTGATTAAGTTGAGGAGTA TGG (reversed) Intergenic
No off target data available for this crispr