ID: 1030215376

View in Genome Browser
Species Human (GRCh38)
Location 7:107039764-107039786
Sequence GTTACATATAAGCAAGTTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030215373_1030215376 5 Left 1030215373 7:107039736-107039758 CCAAGCCATTGACTTTGTTTTTT No data
Right 1030215376 7:107039764-107039786 GTTACATATAAGCAAGTTGATGG No data
1030215375_1030215376 0 Left 1030215375 7:107039741-107039763 CCATTGACTTTGTTTTTTTGGCA No data
Right 1030215376 7:107039764-107039786 GTTACATATAAGCAAGTTGATGG No data
1030215372_1030215376 6 Left 1030215372 7:107039735-107039757 CCCAAGCCATTGACTTTGTTTTT No data
Right 1030215376 7:107039764-107039786 GTTACATATAAGCAAGTTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030215376 Original CRISPR GTTACATATAAGCAAGTTGA TGG Intergenic