ID: 1030225597

View in Genome Browser
Species Human (GRCh38)
Location 7:107146829-107146851
Sequence GTGTTCAGGGGACCACACTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 136}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030225597_1030225606 24 Left 1030225597 7:107146829-107146851 CCAGAGTGTGGTCCCCTGAACAC 0: 1
1: 0
2: 2
3: 14
4: 136
Right 1030225606 7:107146876-107146898 TTTTAGAAATGCCCATTCTGGGG 0: 1
1: 1
2: 7
3: 154
4: 1019
1030225597_1030225604 22 Left 1030225597 7:107146829-107146851 CCAGAGTGTGGTCCCCTGAACAC 0: 1
1: 0
2: 2
3: 14
4: 136
Right 1030225604 7:107146874-107146896 CTTTTTAGAAATGCCCATTCTGG No data
1030225597_1030225602 -4 Left 1030225597 7:107146829-107146851 CCAGAGTGTGGTCCCCTGAACAC 0: 1
1: 0
2: 2
3: 14
4: 136
Right 1030225602 7:107146848-107146870 ACACTGGCAGCTGTATCACTTGG No data
1030225597_1030225605 23 Left 1030225597 7:107146829-107146851 CCAGAGTGTGGTCCCCTGAACAC 0: 1
1: 0
2: 2
3: 14
4: 136
Right 1030225605 7:107146875-107146897 TTTTTAGAAATGCCCATTCTGGG No data
1030225597_1030225603 -3 Left 1030225597 7:107146829-107146851 CCAGAGTGTGGTCCCCTGAACAC 0: 1
1: 0
2: 2
3: 14
4: 136
Right 1030225603 7:107146849-107146871 CACTGGCAGCTGTATCACTTGGG 0: 1
1: 0
2: 1
3: 13
4: 193

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030225597 Original CRISPR GTGTTCAGGGGACCACACTC TGG (reversed) Intronic
905214378 1:36396613-36396635 CTGGTCAGGGGCCCACACTCTGG + Intronic
905933508 1:41806354-41806376 GAGGGCAGGGGACCACACCCAGG - Intronic
906200751 1:43958686-43958708 GTGATCTGGGGACCAAACTGGGG + Intronic
908996503 1:70162370-70162392 CTGTTCTGGGGACCACACTTTGG - Intronic
910981562 1:92963530-92963552 GGCTTCAGGGCACCTCACTCGGG - Intergenic
913180596 1:116317502-116317524 GTCTTGAGGGGAGCACACTGAGG - Intergenic
915433465 1:155885290-155885312 GTGGTCTGGGGACCACAGTTTGG - Intergenic
915475956 1:156153007-156153029 GTGCTCACTGGACCACACTTTGG - Intronic
919466149 1:197922994-197923016 GTTTTCAGGGGAACCCACACAGG + Intronic
919983769 1:202658813-202658835 GGGTTCAGGGGGCCACACACTGG - Intronic
1063239381 10:4152730-4152752 GTATTCCAGGGGCCACACTCTGG - Intergenic
1065236640 10:23658969-23658991 CTGTTCAGGGGACAAGACGCTGG - Intergenic
1065891601 10:30126070-30126092 GGATTCATGGGACCACACCCAGG + Intergenic
1066982687 10:42433462-42433484 GTGCTCATGATACCACACTCAGG - Intergenic
1067095133 10:43294882-43294904 GTGCTCAGGGGACCACACAGAGG - Intergenic
1067958741 10:50823532-50823554 CTGGTCAGGGCACCACACTTCGG - Intronic
1069055629 10:63841647-63841669 GTGTTCAGGCAAGCACAGTCTGG + Intergenic
1069565449 10:69460628-69460650 GTGGTCAGGCCACCACAGTCAGG - Intronic
1072711344 10:97717640-97717662 GTGGTCAGGTGACCTTACTCAGG + Exonic
1076810837 10:132885629-132885651 GTGATGGGGGGAGCACACTCCGG + Intronic
1076810850 10:132885666-132885688 GTGGTGGGGGGAGCACACTCCGG + Intronic
1077444157 11:2582555-2582577 CTGCTCTGGGCACCACACTCAGG - Intronic
1078421770 11:11218599-11218621 GAGTTCTGAGGACAACACTCTGG - Intergenic
1084491422 11:69480694-69480716 GTGTTCAGGTCACCACAGTGAGG + Intergenic
1084595925 11:70117034-70117056 GTGTTCTAGGGAACACACTTTGG + Intronic
1085192396 11:74639108-74639130 CTGGTCTGGGGACCACACTCTGG - Intronic
1091868072 12:3860125-3860147 CTGTTCAGAGGACAACACTAAGG + Intronic
1092062759 12:5564541-5564563 GGGTTCAGGGGAAGACACTGGGG + Intronic
1093029076 12:14271651-14271673 GTGTTCATGCCACCGCACTCTGG - Intergenic
1095054403 12:37582390-37582412 GAGTCCAGGGGAGCACACACTGG - Intergenic
1100551698 12:95651950-95651972 GTGATCACGCCACCACACTCCGG + Intergenic
1102713775 12:114952405-114952427 GGGTGCAGGAGACCACACTGCGG - Intergenic
1102755250 12:115334588-115334610 TTGGTCCGGGGACCACACTGAGG + Intergenic
1103884790 12:124192280-124192302 GTGCTCAGGGGACCAGCCTCAGG + Intronic
1105070100 12:133229115-133229137 GTGTTCAGGGGACAGACCTCTGG - Intronic
1106191574 13:27458177-27458199 GTGATCATGGGACCAAGCTCTGG + Intergenic
1107932216 13:45315712-45315734 GAGTTCAGCGGGCCACACTCAGG - Intergenic
1112108058 13:96263972-96263994 GGGTTGTGGGGACCACTCTCTGG + Intronic
1115159171 14:30373764-30373786 GTCTTCAGGGGCTCACAATCAGG - Intergenic
1120856409 14:89216541-89216563 CTCCTCATGGGACCACACTCAGG + Intronic
1121729624 14:96177279-96177301 GTGGTCAGGGGTACAAACTCCGG + Intergenic
1122661845 14:103301320-103301342 GTGGTCATGGGGCCACACTTAGG + Intergenic
1122849826 14:104522076-104522098 GGGTTCTGTGGACCACACTGAGG + Intronic
1127982044 15:64042470-64042492 CTGTTCCTGGGACCACTCTCAGG - Intronic
1131363282 15:91814593-91814615 GTGTTCATGACACCACATTCTGG + Intergenic
1133012442 16:2921704-2921726 GTGATCACGCCACCACACTCCGG + Intronic
1134630464 16:15752460-15752482 CTGGTCTAGGGACCACACTCCGG - Intronic
1134640812 16:15827894-15827916 TTGTTCAGGTGACCACAGACTGG - Intronic
1138343506 16:56306281-56306303 ATCTTCAGCGGCCCACACTCTGG + Intronic
1140748399 16:78001197-78001219 GAATTCTGGGGAACACACTCTGG + Intergenic
1145371694 17:22311627-22311649 GAGTTCAGGGGAGCACACACTGG - Intergenic
1145374943 17:22338453-22338475 GAGTCCAGGGGAGCACACACTGG - Intergenic
1146719492 17:35113753-35113775 CTGGTCTGGGGACCACACTGGGG - Intronic
1152715494 17:81898392-81898414 GTGTTCAGGGCAACACCCTCTGG - Intronic
1152990619 18:360552-360574 GCGGTCTGTGGACCACACTCAGG + Intronic
1156128791 18:33941791-33941813 GTGATTAGGGGAGCACATTCTGG - Intronic
1156391441 18:36654149-36654171 GTGTTTCGGGGACCCCAGTCTGG + Intronic
1163477836 19:17537368-17537390 GTTTTCAGGAGACCATACTCAGG + Exonic
1165300078 19:34963302-34963324 GTGTTCAAGGAACCCCACCCAGG - Intronic
1166544815 19:43627619-43627641 GAGTGCTGGGGACCAGACTCAGG - Intronic
1166672555 19:44719607-44719629 GTGTACAGGGGACCCCTCTGAGG - Intergenic
1167033808 19:46981033-46981055 GTCTTCTGAGGACCACACTGCGG - Intronic
1168671912 19:58246985-58247007 GTGGTGAGGGTTCCACACTCAGG - Intronic
925196217 2:1928314-1928336 GTCATCAGGGGACCAGACTCAGG - Intronic
926588898 2:14718899-14718921 GGGTTCAGAGGGACACACTCCGG - Intergenic
927174273 2:20394400-20394422 GTGTTCAGGGGACCTGAGCCTGG - Intergenic
930273099 2:49279506-49279528 GTGGTCTAGGGACCACACTTTGG + Intergenic
934900513 2:98156093-98156115 AGGTTCTGAGGACCACACTCTGG + Intronic
936232178 2:110712463-110712485 GTGTGGAGGGGACTACACACGGG - Intergenic
937036408 2:118786100-118786122 GTGTTCAGGGAACCCCTCTGTGG - Intergenic
945956887 2:216094674-216094696 GAGTTCAGAGGAACACACTGTGG + Intronic
947929596 2:233952686-233952708 GTGTTCAGGACAGCTCACTCTGG + Intronic
949077287 2:242068987-242069009 GTGTTCAGGGGAGCAAGCCCCGG - Intergenic
1169703129 20:8471363-8471385 GTGTTCTGTGGAACACACTCGGG + Intronic
1171527853 20:25829958-25829980 GAGTCCAGGGGAGCACACACTGG + Intronic
1171548973 20:26025922-26025944 GAGTCCAGGGGAGCACACACTGG - Intergenic
1172129212 20:32644702-32644724 GTGTTCAAGAGGCCACTCTCTGG - Intergenic
1173327011 20:42043113-42043135 GTGTTCTGTGGACCACACTCTGG - Intergenic
1174106703 20:48167449-48167471 GTGTTCAGGGGATCAGGCTTAGG - Intergenic
1175345219 20:58268270-58268292 GTTTTCAGGGGCCCCCACTGTGG + Intergenic
1175699106 20:61124338-61124360 GTATTAAGGGGAACACACACAGG - Intergenic
1178160330 21:29904903-29904925 GCGTTCATGTGGCCACACTCTGG + Intronic
1179447626 21:41444063-41444085 CTTTTCAGGGGACCACAGTCAGG + Intronic
1179681188 21:43022333-43022355 GGGCTCAGGGGCCCACAGTCAGG - Intronic
1183733089 22:39629225-39629247 GAGTTCAGGGGAGAACAGTCTGG - Intronic
1184647509 22:45904043-45904065 GGGTTCAGGGGTCCACCCTGGGG + Intergenic
1184648857 22:45910490-45910512 GGGTTCAGGGGACAAAACTGGGG + Intergenic
950268385 3:11592744-11592766 TTGTTCAGGGTCACACACTCTGG - Intronic
950426079 3:12925395-12925417 GTGCTCAGGAGCCCAGACTCGGG + Intronic
952119522 3:30225658-30225680 GGGCTCAGGGGACGACACACTGG - Intergenic
961226260 3:125250466-125250488 GTAATCAGAGGTCCACACTCAGG - Intronic
962843075 3:139252768-139252790 TGGTTCCGGGGACCACACTTTGG - Intronic
963500782 3:146122621-146122643 GTGGTCTGGGGTCCACACTTTGG + Intronic
966899836 3:184473261-184473283 CTTTTCAGGGCAGCACACTCAGG + Intronic
967873114 3:194248649-194248671 GTGTTCTGTGGAACACACTTGGG + Intergenic
969281235 4:6172027-6172049 GTGTCCAGGGAACAACAATCAGG - Intronic
969451110 4:7273909-7273931 GTGTCCAGGGGACCATGCTGGGG + Intronic
975958994 4:79877988-79878010 GTTTTCAGAGGACCATTCTCAGG - Intergenic
978510261 4:109509225-109509247 GTGTTCAAGGAACAACACTAAGG + Intronic
979390453 4:120120926-120120948 GTGATCAGGGCTCCACCCTCAGG + Intergenic
980772307 4:137391897-137391919 GTGTTCATGTGATAACACTCAGG + Intergenic
981619095 4:146673513-146673535 GTGTTCTGTGGAACACACTTTGG + Intergenic
983295958 4:165869619-165869641 GTGTTCAGGGTACAACAGTGAGG + Intergenic
990606854 5:57419348-57419370 GTGTTCTGGTGAAAACACTCAGG - Intergenic
990736317 5:58867182-58867204 ATGGTCTGTGGACCACACTCTGG - Intergenic
991595069 5:68295920-68295942 GTTTTCAAGCAACCACACTCAGG - Intronic
993835663 5:92817508-92817530 GTGTTCAGGGGAACTCTCTGTGG + Intergenic
998812376 5:145979150-145979172 CTGGTCTGGGGACCACACTTTGG - Intronic
998872944 5:146570709-146570731 TTGTTTTAGGGACCACACTCTGG - Intergenic
1000045390 5:157518007-157518029 GTGCTCTGGGGACCACATTTTGG + Intronic
1000312698 5:160060845-160060867 GTGTTCCACTGACCACACTCTGG + Intronic
1000761939 5:165236908-165236930 TTGATCAGGGGACCACAATTTGG - Intergenic
1001345609 5:170895019-170895041 TTGGTCAGGGTACCACACTTTGG + Intronic
1002057457 5:176606731-176606753 GTGCTCCAGGGTCCACACTCAGG - Intronic
1004429193 6:15528800-15528822 ATGCTGAGGGGACCACACTTTGG - Intronic
1007635335 6:43296648-43296670 TTGTCCAAGGGACCACACTAGGG + Intronic
1012647942 6:101712238-101712260 CTGCTCAGTGGACCACACACAGG - Intronic
1012771814 6:103447347-103447369 CTGTTCTGGGGACCACATTTTGG + Intergenic
1016264897 6:142221200-142221222 AAGTTCTGGGGACCACACTATGG + Exonic
1017159259 6:151350017-151350039 GGAATCAGGGGAGCACACTCAGG + Exonic
1018014517 6:159699888-159699910 GTTCTCAGTGGACCACAATCTGG - Intronic
1018711094 6:166498693-166498715 GTGTTCGGGGGTCCACACTCAGG + Intronic
1019020866 6:168916669-168916691 GTGTGGAGGGGACCCCACGCAGG + Intergenic
1019901437 7:4023852-4023874 GTGTCCAGTGTTCCACACTCAGG - Intronic
1022497531 7:30862400-30862422 CTGTTCTGGGGACTACTCTCTGG - Intronic
1025297790 7:57789924-57789946 GAGTCCAGGGGAGCACACACTGG - Intergenic
1029651905 7:101899116-101899138 GTGTTCTGGGGTCCAGACCCTGG + Intronic
1030031990 7:105378003-105378025 CTGTTAAGGGGTACACACTCAGG - Intronic
1030225597 7:107146829-107146851 GTGTTCAGGGGACCACACTCTGG - Intronic
1031845802 7:126804963-126804985 GTGGTAAGAGGACCACAGTCTGG - Intronic
1033790453 7:144786800-144786822 GTGTTTAGGGGTACACATTCTGG - Intronic
1035495250 7:159319804-159319826 CTGTTCAAGGGATCACAATCAGG - Intergenic
1035535840 8:390871-390893 GTGTTCAGGGGAGCAAGCCCAGG - Intergenic
1036492190 8:9238026-9238048 GTGGTCACGTGACCACATTCTGG - Intergenic
1045437952 8:102183501-102183523 CTGGTCTGAGGACCACACTCAGG + Intergenic
1046062892 8:109160037-109160059 TTGTTCAGGGAACCAAACTTTGG + Intergenic
1048539314 8:135328026-135328048 GAGTTCAGGGAACCTCACTTTGG + Intergenic
1049657257 8:143804376-143804398 GTGTCAAGGGGACCATACTGAGG + Intronic
1049767885 8:144363373-144363395 CTACTCAGGGGACCACCCTCTGG - Intergenic
1050106762 9:2173851-2173873 GTGTTCTGTGGAGCACACTTTGG + Intronic
1050177589 9:2884232-2884254 GTGTTCAGTGGACAACTCTGTGG + Intergenic
1053795821 9:41726105-41726127 GAGTCCAGGGGAGCACACACTGG + Intergenic
1054149363 9:61588768-61588790 GAGTCCAGGGGAGCACACACTGG - Intergenic
1054184229 9:61938176-61938198 GAGTCCAGGGGAGCACACACTGG + Intergenic
1054469123 9:65519879-65519901 GAGTCCAGGGGAGCACACACTGG - Intergenic
1054654277 9:67650319-67650341 GAGTCCAGGGGAGCACACACTGG - Intergenic
1062477581 9:136736299-136736321 TGGTTCAGAGGCCCACACTCGGG + Intergenic
1187027657 X:15452706-15452728 GTGGTCTGGGGACCACTCTTTGG - Intronic
1189122019 X:38405048-38405070 GTCTTCAGGGGACAGCTCTCTGG - Intronic
1192232581 X:69276174-69276196 GAGTCCAGGGGACCACACTGTGG - Intergenic
1193376613 X:80768821-80768843 GTATTCAGGAGACCCAACTCAGG + Intronic
1197252805 X:124232808-124232830 CTGATCTGGGGACCACACTTTGG + Intronic
1198950852 X:142070508-142070530 CTGGTCTGGGGACCACACTTTGG - Intergenic