ID: 1030226647

View in Genome Browser
Species Human (GRCh38)
Location 7:107159203-107159225
Sequence ATGAGCAATGCTAAGTTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 112}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030226647_1030226655 24 Left 1030226647 7:107159203-107159225 CCCACCAACTTAGCATTGCTCAT 0: 1
1: 0
2: 0
3: 12
4: 112
Right 1030226655 7:107159250-107159272 GTGGTCCAAGAGCGTGGCCCTGG 0: 1
1: 0
2: 1
3: 10
4: 189
1030226647_1030226651 -9 Left 1030226647 7:107159203-107159225 CCCACCAACTTAGCATTGCTCAT 0: 1
1: 0
2: 0
3: 12
4: 112
Right 1030226651 7:107159217-107159239 ATTGCTCATCATATTGCCGAGGG 0: 1
1: 0
2: 0
3: 8
4: 109
1030226647_1030226650 -10 Left 1030226647 7:107159203-107159225 CCCACCAACTTAGCATTGCTCAT 0: 1
1: 0
2: 0
3: 12
4: 112
Right 1030226650 7:107159216-107159238 CATTGCTCATCATATTGCCGAGG No data
1030226647_1030226654 18 Left 1030226647 7:107159203-107159225 CCCACCAACTTAGCATTGCTCAT 0: 1
1: 0
2: 0
3: 12
4: 112
Right 1030226654 7:107159244-107159266 CAGAGTGTGGTCCAAGAGCGTGG 0: 1
1: 0
2: 0
3: 11
4: 146
1030226647_1030226652 5 Left 1030226647 7:107159203-107159225 CCCACCAACTTAGCATTGCTCAT 0: 1
1: 0
2: 0
3: 12
4: 112
Right 1030226652 7:107159231-107159253 TGCCGAGGGACTGCAGAGTGTGG 0: 1
1: 0
2: 0
3: 16
4: 187

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030226647 Original CRISPR ATGAGCAATGCTAAGTTGGT GGG (reversed) Intronic
902689544 1:18101663-18101685 ATGAGTAATGGTAGGTGGGTGGG - Intergenic
908161734 1:61415933-61415955 ATGTACAATACTCAGTTGGTAGG - Intronic
910489282 1:87750708-87750730 ATGAGTTATGCTAATTTGTTAGG - Intergenic
910703392 1:90101210-90101232 CTGCTCAGTGCTAAGTTGGTGGG + Intergenic
911475286 1:98366371-98366393 ATGAGCAATACTCAGGTGGAAGG - Intergenic
912234161 1:107830653-107830675 ATGAGCAAAGATATGTTGGAAGG - Intronic
912597676 1:110895434-110895456 ATGAGGAATGGGATGTTGGTGGG - Intronic
913524973 1:119682355-119682377 ATGAGCAGTCTTAAGTTGGTAGG - Intronic
914965521 1:152254026-152254048 ATAAGCCATGCTAAGATGCTAGG - Intergenic
1067271035 10:44791441-44791463 CTGAGCAATCCTGAGTGGGTTGG + Intergenic
1067720657 10:48725340-48725362 ATGGGCCATGCTACGGTGGTGGG + Intronic
1069447753 10:68489575-68489597 TTGAGTAATGCTTAGTTGGGAGG - Intronic
1070354679 10:75628347-75628369 ATGAAAAATGCTAAGTTTGAGGG + Intronic
1081613753 11:44578697-44578719 ATCAGCAATGGAAAGTTGGTTGG + Intronic
1085453699 11:76654276-76654298 ATGAGCAGTGCTGAGTTTGGGGG + Intergenic
1086810717 11:91306997-91307019 ATCAACAATGCTAAGTTGCTGGG + Intergenic
1088306855 11:108420036-108420058 ATGAGGATTGCAAAGTTGTTGGG + Intronic
1090810637 11:130238565-130238587 AGGAGCAATGTAGAGTTGGTAGG + Exonic
1098065515 12:66611742-66611764 ATCAGCAAAGATAAGCTGGTTGG + Intronic
1100800265 12:98223356-98223378 AAGACAAATGTTAAGTTGGTTGG - Intergenic
1101502321 12:105315677-105315699 ATGAGCAAAGGTATGGTGGTGGG + Intronic
1102686997 12:114732555-114732577 ATGGGCAGTCCTAGGTTGGTGGG + Intergenic
1102831930 12:116010538-116010560 ATGAGGAATGCACAGTAGGTAGG + Intronic
1102912463 12:116727926-116727948 ATGAGACTTGCTAATTTGGTGGG - Intronic
1103430361 12:120879550-120879572 ATGAGCTATGAGAAGTTGGGCGG - Intronic
1106698381 13:32202975-32202997 ATTAGTGATGCTAAGTTTGTAGG + Intronic
1108135875 13:47358773-47358795 ATCAACAAGGATAAGTTGGTAGG - Intergenic
1109862131 13:68213676-68213698 GTGAGAAATGCTAAGGTTGTAGG - Intergenic
1110031157 13:70615697-70615719 AAGAGAAATGCTTATTTGGTAGG - Intergenic
1110422603 13:75329814-75329836 TTGAGCAATGCTAAGATATTTGG - Intronic
1115755217 14:36521841-36521863 GTGATCAATGCTCAGTTCGTCGG - Intergenic
1117027001 14:51631035-51631057 ATGAGCAATCCTTTCTTGGTGGG - Intronic
1117799777 14:59431262-59431284 ATGAGAAATGATTGGTTGGTTGG + Intronic
1118019222 14:61694498-61694520 ATGTGCAATGCTACTTTGTTGGG + Intergenic
1119969116 14:78949525-78949547 ATGTGCCATGCTTAGTTGTTGGG + Intronic
1120214159 14:81663929-81663951 ATGAGTAATGACAAGATGGTTGG + Intergenic
1120376241 14:83711016-83711038 ATAAGCAATGTTATGTTGATGGG + Intergenic
1124047103 15:26160506-26160528 ATGTGCAAAACTATGTTGGTGGG + Intergenic
1135849644 16:25951553-25951575 CTGAGCTTTGCTAAGTAGGTTGG - Intronic
1139659709 16:68412189-68412211 ATGAGGAATGAGCAGTTGGTGGG + Intronic
1140189757 16:72805338-72805360 GTGAGCAATGCCAAGGCGGTAGG - Intronic
1146327890 17:31902608-31902630 CTTAGAAATGCTAAGTTGCTTGG - Intergenic
1149275966 17:55037292-55037314 ATGAGGAAGGCAAAGATGGTTGG + Intronic
1151317693 17:73333814-73333836 ATGAGAAATGCTATGTTGTTTGG - Intergenic
1151419334 17:73987050-73987072 AGGAGCAATGGAAAGTTGGAAGG + Intergenic
1156973785 18:43191558-43191580 AAGAGCAATGCTTACTTGGGGGG - Intergenic
1157942919 18:51948922-51948944 ATCAGCAATTTTAAGTTGGCAGG + Intergenic
1158226321 18:55205235-55205257 ATGGGAAATGCTGGGTTGGTAGG - Intergenic
1158659569 18:59374039-59374061 ATGATCAATGCTACCTTGGCAGG + Intergenic
1158957831 18:62557843-62557865 ATGAGCAGTGCTAAAGAGGTTGG + Intronic
1166037207 19:40177516-40177538 ATGAGGAATGCTGAGTGGTTGGG - Intergenic
930055001 2:47245117-47245139 ATGAGCAATGCCAAATTATTTGG + Intergenic
930232525 2:48857570-48857592 ATGAGAAATGCCATGTTGGCTGG + Intergenic
930991876 2:57665990-57666012 TTGACAAATGCTAAGTTGGAGGG - Intergenic
931373434 2:61686015-61686037 ATGAGCAAGGCAAGGTTGTTCGG - Intergenic
933261498 2:80136403-80136425 ATTGCCAATGCTAAGTTTGTTGG + Intronic
934073414 2:88406890-88406912 AGAAGCAATGCTATGTGGGTCGG - Intergenic
937090536 2:119203288-119203310 CTGGGCAATGCCATGTTGGTGGG + Intergenic
938595729 2:132785345-132785367 TGGAGCAATGCTAAGGTGGAAGG + Exonic
940755848 2:157682420-157682442 ATTGACAATGCCAAGTTGGTGGG + Intergenic
941191564 2:162390522-162390544 ATGAGCATTGTTAAGATGGCTGG - Intronic
941876227 2:170436226-170436248 ATGAGCAATGCTTAGCTGGGAGG + Intronic
942996137 2:182263054-182263076 ATGAGCAATGTTAAACTGGATGG - Intronic
943539398 2:189193197-189193219 ATAAGCAATGCAATGTTGCTTGG + Intergenic
943855829 2:192789000-192789022 ATGAGTGATACTGAGTTGGTTGG + Intergenic
945661531 2:212691590-212691612 ATGAGCAATGATAGGAAGGTGGG - Intergenic
946259186 2:218471610-218471632 ATGAGGAAGGCACAGTTGGTGGG - Intronic
1171038890 20:21741663-21741685 ATGAGAAATGATAAGTGAGTAGG - Intergenic
1171258906 20:23713691-23713713 ATGTGCACAGGTAAGTTGGTGGG + Intergenic
1172202565 20:33136859-33136881 ATAAGCCATGCTCAGTTGGGAGG + Intergenic
1173830147 20:46078357-46078379 ATGCGTAATGCTCAGTTAGTTGG + Intronic
1175216052 20:57392076-57392098 ATTAGGACTCCTAAGTTGGTGGG + Intronic
1180186142 21:46140312-46140334 CTGAGCAATGCGAAGGTGGACGG - Intronic
1180186183 21:46140513-46140535 CTGAGCAATGCGAAGGTGGACGG - Intronic
1182433642 22:30316047-30316069 AGGAGCAATGGGAAATTGGTAGG - Intronic
1183009310 22:34931870-34931892 GTGAGCAATGGAAATTTGGTTGG - Intergenic
951626706 3:24673039-24673061 ATGAGAAGTGAGAAGTTGGTAGG + Intergenic
959143165 3:102510797-102510819 ATGAGCAATGCTAATTTCAAAGG + Intergenic
959562698 3:107800705-107800727 ATGAGAAATGCTTAGTCAGTTGG + Intronic
960216177 3:115040662-115040684 ATAAGCCATGCTAAGGTGTTTGG + Intronic
963507752 3:146208410-146208432 AAAAGCAATGATAAGTAGGTGGG + Intronic
964043473 3:152293387-152293409 TCCAGAAATGCTAAGTTGGTTGG + Intronic
971034090 4:22674516-22674538 ATGAACAATGCTAGGTCGGGTGG - Intergenic
971456886 4:26853345-26853367 ATGATAAGTGCTAAGTGGGTGGG - Intergenic
971577726 4:28297910-28297932 AATGTCAATGCTAAGTTGGTGGG + Intergenic
974117184 4:57593377-57593399 ATGGGCAATGCTGAATTCGTAGG + Intergenic
975618816 4:76275221-76275243 ATGAGCAAGGCTAAGGTGGCAGG - Intronic
979009573 4:115350400-115350422 ATCAGCAATGATGAGTTTGTTGG + Intergenic
979763588 4:124437053-124437075 ATGGGCAATGCTAACCTGTTGGG - Intergenic
986645095 5:9909446-9909468 AGGAGCTATGCTACGTTGGAAGG + Intergenic
987356425 5:17067162-17067184 ATGTGCAATACGAAGGTGGTAGG + Intronic
987903506 5:24046192-24046214 ATGAGAAATGAAAATTTGGTTGG - Intronic
989689708 5:44126445-44126467 AAAAACAATGATAAGTTGGTGGG + Intergenic
990440905 5:55844215-55844237 ATAAACAATTCTAGGTTGGTGGG - Intergenic
992502252 5:77354730-77354752 AGGAGCAAGGCTGAGTTGGTGGG - Intronic
995665428 5:114536412-114536434 ATGAGCAAGGCTCAGTGGGAAGG + Intergenic
995853347 5:116569891-116569913 ATAACCAATGCTTAGTGGGTAGG - Intronic
997164616 5:131646593-131646615 AGGAGGAATGGGAAGTTGGTAGG - Intronic
998083599 5:139297216-139297238 ATGGACAGTGCTAAGTTTGTTGG + Intronic
998601078 5:143585699-143585721 ATGAGAAATGCTAAGATTGCTGG + Intergenic
999460323 5:151752159-151752181 CTGAGCAATGCTGATCTGGTGGG + Intronic
1000873188 5:166602763-166602785 AGGATCAATGCTCAGTTGGATGG + Intergenic
1003784163 6:9465103-9465125 ATTAGCTATGCTAATTTGGTGGG - Intergenic
1004709560 6:18156182-18156204 ATGAGCATTGCCAGGTTGCTGGG + Intronic
1008128220 6:47691980-47692002 AGGAGCAAAGCTAAATTGGAAGG - Intronic
1017112390 6:150944786-150944808 ATGAGCACTGCCAAGTTATTGGG + Intronic
1018571897 6:165220655-165220677 ATGAGCAATGATAAATTGGAAGG + Intergenic
1019318250 7:401434-401456 ATGAGCAAAGCAATGTTGGGGGG + Intergenic
1019657448 7:2203523-2203545 ATTAGCCATGCTATGCTGGTTGG - Intronic
1023722278 7:43108891-43108913 CAGAGAAATGCTAAGTTTGTGGG + Intergenic
1030226647 7:107159203-107159225 ATGAGCAATGCTAAGTTGGTGGG - Intronic
1037553031 8:19993242-19993264 AGGAGCATTTCCAAGTTGGTAGG - Intergenic
1042274118 8:66985537-66985559 ATCAGCAATGCCAACATGGTGGG - Intronic
1045183471 8:99811939-99811961 ATGAGTAACACTAAGTTGGACGG + Intronic
1046090991 8:109502503-109502525 AAGTGCGATGCTAAGTTAGTTGG - Intronic
1049460552 8:142725711-142725733 GTGAGCAATGCTAGGGTGTTGGG + Intergenic
1051281852 9:15449242-15449264 TTGAGCAATGTTCAGATGGTTGG - Intronic
1051566989 9:18510985-18511007 ATGAGCAAAGCTAAATTAGCTGG - Intronic
1058698820 9:107584327-107584349 ATGAGTCATGCTAAGGTGCTTGG - Intergenic
1186253235 X:7691747-7691769 ATGACCAATGCTAGGTTAGTTGG + Intergenic
1188051667 X:25495202-25495224 ATGAGCAGAGCTCAGTTGCTGGG + Intergenic
1190420884 X:50283176-50283198 CTCAGAAATGCTAAGTTGGCTGG + Intronic
1194889211 X:99356413-99356435 ATGACCAATGCTACGTTGATAGG - Intergenic
1195066445 X:101242383-101242405 ATCAGAAATGGCAAGTTGGTGGG - Exonic
1198148235 X:133880564-133880586 ATGAGCAAAGCTAAATAGGTGGG - Intronic