ID: 1030230007

View in Genome Browser
Species Human (GRCh38)
Location 7:107197883-107197905
Sequence CAGGAAAAACAAATTGAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 570
Summary {0: 1, 1: 0, 2: 1, 3: 38, 4: 530}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030230007_1030230010 9 Left 1030230007 7:107197883-107197905 CCTTGCTCAATTTGTTTTTCCTG 0: 1
1: 0
2: 1
3: 38
4: 530
Right 1030230010 7:107197915-107197937 CTGGCCTTAGATTTAGTGACAGG No data
1030230007_1030230008 -10 Left 1030230007 7:107197883-107197905 CCTTGCTCAATTTGTTTTTCCTG 0: 1
1: 0
2: 1
3: 38
4: 530
Right 1030230008 7:107197896-107197918 GTTTTTCCTGAGAAAATGACTGG 0: 1
1: 0
2: 2
3: 24
4: 296

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030230007 Original CRISPR CAGGAAAAACAAATTGAGCA AGG (reversed) Intronic
900332207 1:2141301-2141323 AACAAAAAACAAATTGACCAAGG - Intronic
900888100 1:5429698-5429720 GAGGAAAAACAAAAGGGGCAGGG + Intergenic
901266834 1:7917337-7917359 CAGGATAGACAAATTGACAATGG + Exonic
901487403 1:9574252-9574274 CAAGAAAAACAAAATTAGCTGGG - Intronic
902192055 1:14770635-14770657 CTGGAGAAACAAATTTAGCCTGG + Intronic
902386236 1:16077492-16077514 CAGCAAATACTTATTGAGCATGG - Intergenic
902464724 1:16608994-16609016 AAGGAAAAATAAGCTGAGCATGG + Intronic
902877157 1:19347608-19347630 CTGGACAAACAAGTTGACCAAGG - Intronic
903167058 1:21527891-21527913 AAGGAAAAAAAGATTGAGCTGGG - Intronic
903539296 1:24087715-24087737 AAGGAGAAAGACATTGAGCAGGG - Intronic
903582610 1:24383263-24383285 CAAGAAAAACAGATACAGCAAGG - Intronic
905155409 1:35974867-35974889 CAGGAAATATAAGATGAGCAAGG - Intronic
905210696 1:36372185-36372207 CTAGAAAAAGAAATTGAGCCCGG + Intronic
906082590 1:43102956-43102978 CAGGAAAATTAAAATCAGCAGGG - Intergenic
907348863 1:53809100-53809122 GAGGAAACCAAAATTGAGCAAGG - Intronic
907398312 1:54207987-54208009 CTGGAAAAACACCTTGAGAATGG - Intronic
907791273 1:57667018-57667040 TAGGAAGAGCATATTGAGCAAGG - Intronic
908156711 1:61360786-61360808 CAGTAAAATTAACTTGAGCAGGG - Intronic
908174450 1:61540511-61540533 CAGGAAAAACCAATTAGGAATGG + Intergenic
908770048 1:67587663-67587685 AAGAAAAAAAAAATTGAGAATGG - Intergenic
908827606 1:68148663-68148685 GAGGAAAACCAAATTGAGAAGGG + Intronic
908944915 1:69483738-69483760 CAGGAAAAATAAATTATCCAAGG - Intergenic
909578606 1:77205773-77205795 TAGGAAAAACAAATCTATCATGG + Intronic
909749378 1:79139708-79139730 AATGAAAAGCAAATTTAGCAGGG - Intergenic
909866257 1:80675941-80675963 CAGGAAGAAGAACTAGAGCAGGG + Intergenic
910335057 1:86118889-86118911 AAAGAAAAACTAATAGAGCAAGG + Intronic
910380587 1:86622708-86622730 GAGGAAAAACTAATAGATCATGG + Intergenic
910996418 1:93109073-93109095 TAGTAAAAATAAAATGAGCAGGG - Intronic
911251634 1:95583156-95583178 AAGGAAAAAAAAATTGGCCAAGG + Intergenic
912327983 1:108786632-108786654 AAGGATAGACAAATTGACCATGG - Intronic
912964609 1:114226939-114226961 CAGGAAAAAAAAATGGTGCCTGG + Intergenic
914351516 1:146843989-146844011 CAGGTAAAACAAAGTTAACAAGG - Intergenic
915001034 1:152591758-152591780 CAAGAAAAAAAATTTGAACATGG - Intronic
915086879 1:153395056-153395078 AAGGAAAAAGAAACAGAGCAAGG + Intergenic
915182472 1:154074392-154074414 GAAGAAAAATAAATTGAGGAAGG - Intronic
915614116 1:157022306-157022328 CAATAAAAACAAAGTCAGCAAGG + Intronic
916090445 1:161304864-161304886 CAGGAAAAACAAATGGGAAATGG - Exonic
916710621 1:167403504-167403526 GAGGAAAAACAAATTAAAAAGGG - Intronic
917154462 1:171981565-171981587 CATGAAAAACAAATTATGCTAGG - Intronic
917934986 1:179857426-179857448 CAGGAAATAGAAATTAAGCAAGG - Intronic
918502431 1:185212351-185212373 CAGGAAAAACAGATGGAAGATGG - Intronic
919283601 1:195523578-195523600 AAGCAAAAACAAAATGGGCAAGG + Intergenic
919671153 1:200339397-200339419 CAGGATAATGAAATTGACCAGGG + Intergenic
919754708 1:201059414-201059436 GAGCTAAAACAAAGTGAGCAGGG - Intronic
919954292 1:202397328-202397350 AAAGAAAAACAAATTTAGCATGG - Intronic
920653816 1:207859787-207859809 CAGGAAGAACATATTGGGGAGGG + Intergenic
920938544 1:210458700-210458722 CAGGAAAAATAGATTGGGCTTGG + Intronic
921379070 1:214505309-214505331 CAGGAGAAACATCTCGAGCAGGG + Intronic
921568138 1:216745479-216745501 AAGCAAAAACATATTGGGCATGG - Intronic
922074344 1:222228011-222228033 CAGGAAAAAGAGCTTGTGCAGGG + Intergenic
924083261 1:240421204-240421226 CAGGAAAAAAAAGTTGGCCAAGG - Intronic
924304794 1:242676534-242676556 AATGAAAAAAAAATGGAGCAGGG + Intergenic
1063398219 10:5713754-5713776 CAGGAAAACCAAACTAAGCAGGG - Intronic
1063499709 10:6542416-6542438 CAGTAAATACTCATTGAGCATGG + Intronic
1063854458 10:10232544-10232566 AAGGAAAAAAAAATGTAGCAAGG - Intergenic
1065163926 10:22954732-22954754 TAGAGAAAACAAATTGAGGAGGG - Intronic
1068447461 10:57140532-57140554 CAGGAAAAACGAAAAAAGCATGG + Intergenic
1068496535 10:57790626-57790648 AAGGAAAAAGAAAATGAGGAAGG + Intergenic
1070603182 10:77879799-77879821 CAGGAAAAACAGATGGGGGAGGG + Intronic
1071674719 10:87644676-87644698 CAGGAAAGAGAGCTTGAGCAGGG - Intergenic
1071776263 10:88791776-88791798 CAGAAAAAAAAAATAGAGAAGGG - Intergenic
1071777572 10:88806341-88806363 CAGGAGGAGCAAAATGAGCAGGG - Intronic
1072880421 10:99221612-99221634 AAGGAGAAAAAACTTGAGCAGGG + Intronic
1073817731 10:107225649-107225671 CAGGAAAAAAAAACTGTCCATGG - Intergenic
1074033887 10:109718346-109718368 CAGGAAAAACACATGGAAGATGG + Intergenic
1074295663 10:112185441-112185463 TAGAAAAAATAAACTGAGCATGG + Intronic
1074575281 10:114663119-114663141 CAGGAAAAGCAAAAGAAGCAGGG - Intronic
1075417761 10:122277955-122277977 CAGCCAAATCAAAGTGAGCATGG + Intronic
1076943269 10:133624561-133624583 CAGGAAAAAAAAAATTAGCCAGG + Intronic
1078953535 11:16163544-16163566 CAGGAAAAACAAAATCTGGAGGG + Intronic
1079458677 11:20660571-20660593 AAGGAAAAACATATTTAGAAGGG - Intergenic
1079723635 11:23850634-23850656 CAGGAATAATCAATTAAGCAAGG + Intergenic
1079982055 11:27161539-27161561 CAGAAAATACAAAGTGAGCCTGG + Intergenic
1079985339 11:27194138-27194160 GAGGAAAAAAAAATTCTGCAGGG + Intergenic
1080630846 11:34074176-34074198 CAAGAAAAAGAAATTGGGCAGGG - Intronic
1080741218 11:35066118-35066140 CAGGGAAAACAATTTAAGAAGGG - Intergenic
1080786825 11:35482998-35483020 CAGTCAAAAGAAATAGAGCATGG - Intronic
1080974304 11:37318656-37318678 AAGGACAAATAAATTTAGCAAGG - Intergenic
1081088159 11:38826311-38826333 AATGAAAAACAAATAAAGCAGGG + Intergenic
1081317621 11:41650185-41650207 GAGGAAAAACCAATAGAGAAAGG - Intergenic
1081554881 11:44149412-44149434 CAGAAAAAAGAAATAGAACATGG - Intronic
1082915040 11:58424335-58424357 GAGGAAAGACAAATTGAAGAAGG - Intergenic
1083269688 11:61565570-61565592 GAGGAAAAACAAATTGAGATAGG + Intronic
1083465333 11:62842011-62842033 TATGCAAAACAAACTGAGCAGGG - Intergenic
1085128137 11:74015914-74015936 AAGGAAAAAAAAAATTAGCAGGG + Intronic
1086138817 11:83471580-83471602 TAGGAAAAACAAAAAGAGCTTGG - Intronic
1086438256 11:86802255-86802277 CAGGTAAACTAAATTGAGCCTGG - Intronic
1086502241 11:87465328-87465350 CAGGATAATAAAATTGAGAATGG + Intergenic
1087665100 11:101035563-101035585 TAGTAAAAATAATTTGAGCATGG + Exonic
1087832066 11:102830072-102830094 CAGCACAAAGAAATTTAGCAGGG + Intergenic
1089165437 11:116472406-116472428 CAGGAACAACAAAATGCTCAAGG - Intergenic
1089646316 11:119881943-119881965 TAGGCAAAAAAAAATGAGCATGG - Intergenic
1089648739 11:119897766-119897788 CAGGAAAGAAAGAGTGAGCAGGG - Intergenic
1090742263 11:129675212-129675234 CAGAAAACACAAAAAGAGCAGGG + Intergenic
1092612196 12:10184396-10184418 CAGGCAAAACAAATTGTGATTGG + Intronic
1093709990 12:22319704-22319726 CAAGAAAAACCTATTGAGAATGG + Intronic
1094086586 12:26599875-26599897 AAGGAAAAAAAAATGAAGCAAGG + Intronic
1094407173 12:30128681-30128703 CAGAAAAAACAAAATATGCAAGG + Intergenic
1094421505 12:30276532-30276554 CAGGAAAAACATAATGCTCAAGG - Intergenic
1094546329 12:31407758-31407780 CAGGAAAAAGACAATGAGCCTGG + Intronic
1094672703 12:32586599-32586621 AAGGGAAAACAGATGGAGCAGGG + Intronic
1094796848 12:33984189-33984211 CAGGAAACACAAGATCAGCATGG - Intergenic
1095109592 12:38278137-38278159 CAGGAAACACAAGATCAGCACGG - Intergenic
1095232710 12:39760674-39760696 AATGAAAAACAAATTAAGAAAGG - Intronic
1095237728 12:39818273-39818295 CAGGAAAAAAAAAATGAGTTGGG + Intronic
1095522474 12:43084255-43084277 CAGGAAAGACAACGTGTGCAAGG - Intergenic
1095577327 12:43756007-43756029 CAGGAAAGATAAATTGCCCAGGG + Intronic
1095918777 12:47507886-47507908 CAAGAAATACCATTTGAGCATGG - Intergenic
1096163980 12:49404975-49404997 CAAAAAAAAAAAAATGAGCATGG - Intronic
1098351537 12:69567040-69567062 CAGGAAGCACTAATTGAGCTGGG - Intronic
1098771725 12:74560778-74560800 CAGGGAAAACAGAGTGTGCAGGG + Intergenic
1098990373 12:77059299-77059321 CAGGACAGACAGATGGAGCAAGG - Intronic
1099113504 12:78593160-78593182 CAATAAAAACAAACTAAGCAGGG - Intergenic
1100057642 12:90532424-90532446 CTGGAAAAAAAAAATAAGCAGGG - Intergenic
1100240729 12:92708240-92708262 CAGGAAGATAAAATTGGGCATGG - Exonic
1100695722 12:97090576-97090598 TAGGAAAAAATAAATGAGCATGG + Intergenic
1100730337 12:97460169-97460191 CAGAAAAAAAAAATTGTGAAAGG - Intergenic
1102126952 12:110491053-110491075 AAAAAAAAACAAATTTAGCAAGG - Intergenic
1102409546 12:112705449-112705471 AAGGAAAAATAATTTGTGCAAGG + Intronic
1104362176 12:128144314-128144336 CATGAATAACAAAGCGAGCAAGG - Intergenic
1104715352 12:131012702-131012724 AAGGAAAAACAAGTTGAGGGAGG + Intronic
1107580357 13:41777280-41777302 CAGGAAAAACCTATTCAGCCAGG + Intronic
1107695969 13:43000308-43000330 CTGAAAAAACAAAGTGAGCAGGG + Intergenic
1107920735 13:45204318-45204340 CAGGAATAACAAATGAAACACGG - Intronic
1108760992 13:53564135-53564157 CAAGAAAGAGAAATTAAGCAAGG - Intergenic
1108907336 13:55494414-55494436 CAGTAAAAACAAGTGGTGCATGG - Intergenic
1109154902 13:58896910-58896932 CAAGAAGAACAAATTGACAATGG + Intergenic
1110019420 13:70451247-70451269 CAGGAAAGACAGTTTGTGCAGGG - Intergenic
1110621157 13:77597304-77597326 CAGAAAAAACAAATGCTGCAAGG + Intronic
1111089336 13:83422475-83422497 AAAGAAAAGGAAATTGAGCATGG + Intergenic
1112068210 13:95817421-95817443 CAGGAGAAACAAAATTAGCTGGG + Intronic
1113189326 13:107725896-107725918 CAGGAAAAACCCATTCAGCTGGG + Intronic
1113303604 13:109051324-109051346 CAGGCAAAATAATTTGAGTATGG + Intronic
1113377276 13:109776259-109776281 CAGTAAAAACACAGTAAGCAAGG + Intronic
1113437610 13:110306206-110306228 CTAGAAAAACAATTTGTGCATGG + Intronic
1114148210 14:20003427-20003449 GAAGAAAAACAAATAAAGCAAGG - Intergenic
1115654450 14:35429941-35429963 CAGGGGAAACAAATAGAGAAGGG + Intergenic
1116064950 14:39970811-39970833 CAGAAGAAACAATTTGACCAAGG - Intergenic
1116162879 14:41291777-41291799 AATGAAAAACAAAAAGAGCAGGG + Intergenic
1116319130 14:43437119-43437141 CAGTAAAGAAAAATTGAGGAAGG - Intergenic
1116837383 14:49783409-49783431 CTGGAAAAACAAAGTGTGGAGGG + Exonic
1117362015 14:54984782-54984804 AAGAAAAAACAAATTTTGCATGG - Exonic
1117505675 14:56400553-56400575 CTGGAAAAACAAGCTCAGCAAGG + Intergenic
1117541104 14:56747373-56747395 AAGGAAAAAAAAAATGAGAAAGG - Intergenic
1117605851 14:57428342-57428364 CAGGTAATACACATTGAACAAGG - Intergenic
1117987866 14:61406193-61406215 CAGGAAAAAAAAAATGTACAGGG + Intronic
1118464889 14:66022099-66022121 CAGGAAAAAAATATTGTTCAGGG + Intergenic
1119291800 14:73501277-73501299 CAAGAAAAACAAAATTAGCCAGG - Intronic
1119489223 14:75016081-75016103 CGGGAAAAATAGATTGAGAATGG + Exonic
1119822511 14:77629995-77630017 CAGAAGAAAGAATTTGAGCAAGG + Intergenic
1120142254 14:80941941-80941963 CAAAAAAAAAAAATAGAGCAGGG - Intronic
1120661903 14:87259967-87259989 CATGTAAAACAATTTGGGCAAGG + Intergenic
1120866437 14:89299315-89299337 CAGGCAAGACAGCTTGAGCAGGG - Intronic
1121356078 14:93216205-93216227 CAGAAAATACAAAATTAGCAGGG - Intronic
1121593701 14:95141518-95141540 CAGGAAAAACAAATTGGCAGTGG + Intronic
1121625787 14:95384606-95384628 AAGGAAAAAGACATTGAGGATGG - Intergenic
1121883540 14:97522290-97522312 CAGGAAAAACCAAAAGAGAAAGG - Intergenic
1122947356 14:105018728-105018750 AAAAAAAAAAAAATTGAGCAGGG - Intronic
1123166917 14:106334475-106334497 CAGGAAAAACAAATGGAAAAAGG + Intergenic
1123169532 14:106359186-106359208 CAGGAAAAACAAATGGAAAAAGG + Intergenic
1123470472 15:20548195-20548217 GAGGAATAAAAAAGTGAGCATGG + Intergenic
1123647587 15:22452505-22452527 GAGGAATAAAAAAGTGAGCATGG - Intergenic
1123693678 15:22861144-22861166 CTGGAAAAACAAATTATACAGGG - Intronic
1123730771 15:23143173-23143195 GAGGAATAAAAAAGTGAGCATGG + Intergenic
1123748910 15:23340599-23340621 GAGGAATAAAAAAGTGAGCATGG + Intergenic
1124119042 15:26872758-26872780 AAGGAAAAAGAAAAAGAGCAGGG + Intronic
1124789530 15:32714946-32714968 TAGGAAAAAAAAATTGCACATGG - Intergenic
1125211225 15:37217511-37217533 CAGGCATACCAAATTGAGCATGG - Intergenic
1125225502 15:37390734-37390756 CAGGAAAGACAGAATGAGGAGGG + Intergenic
1125602267 15:40922162-40922184 CAGGAGAAACAAAGTGAGTTTGG + Intergenic
1125624871 15:41099983-41100005 CAGGTAAAATAACTAGAGCATGG - Intronic
1125694687 15:41625384-41625406 GAGAAAAAAAAAATTGAACAAGG + Intronic
1126826673 15:52558159-52558181 CAAGAAAAACAGACTGGGCACGG + Intronic
1127064439 15:55222342-55222364 CAGGAAAAACACATAGAGTAGGG - Intronic
1127170214 15:56293174-56293196 TATGAAAAAAAAAATGAGCAGGG + Intronic
1127953145 15:63829752-63829774 AAGGAAAAATAAGATGAGCATGG + Intronic
1128394996 15:67215555-67215577 CAGGAAAAACATTTTGTGCAGGG - Intronic
1130328938 15:82904566-82904588 CAGGAGAAACTAATTTACCAGGG + Intronic
1130712950 15:86301964-86301986 GAGGAAAAACAAATTTAAGATGG - Intronic
1130810522 15:87372805-87372827 CAGGAAAAACAAATAAATAAAGG - Intergenic
1131695074 15:94868176-94868198 CAGGAAAAAGAAAGAGAGCAAGG + Intergenic
1132755342 16:1481822-1481844 AAGGAAAAAAGAAATGAGCAGGG + Intergenic
1132758161 16:1495998-1496020 CAGGGAAAACAGAGCGAGCATGG - Intronic
1133598541 16:7316834-7316856 CTGGAAAAACAAAGGGACCAGGG + Intronic
1133735797 16:8614721-8614743 CAGGAAAGAGAAATTGTGCAGGG - Intergenic
1134033133 16:11008599-11008621 AAGGAAAAAAAAAGGGAGCAGGG - Intronic
1135074021 16:19377771-19377793 TAGAAAAGACACATTGAGCAGGG + Intergenic
1135784051 16:25332068-25332090 CAGGCAAAAGAGCTTGAGCAGGG - Intergenic
1135858798 16:26036404-26036426 CAGGAAATACAGATTGGGCAGGG - Intronic
1135987525 16:27194934-27194956 CAGGCAAAACAGCTTGTGCAGGG + Intergenic
1137387975 16:48058390-48058412 CAGGGAAAACACATAGAGAAAGG - Intergenic
1137508095 16:49074088-49074110 AAGAAAAAAAAAATTGAGCCAGG + Intergenic
1138191918 16:55020629-55020651 CAGGAAAAACAAATACTGAAGGG + Intergenic
1138237079 16:55393151-55393173 CAGGAATGACAATTTGAGGAAGG + Intronic
1138240041 16:55420049-55420071 CAGGAAAAATAAATCGGGTAGGG - Intronic
1138960824 16:62026976-62026998 AAGGAAGAAGAAATTGAGCAAGG + Intronic
1139929002 16:70510196-70510218 CAGGACAAGGAAAGTGAGCATGG + Intronic
1139982520 16:70871549-70871571 CAGGTAAAACAAAGTTAACAAGG + Intronic
1140235856 16:73158007-73158029 CAGGAAAAAAAAAATGAGACAGG + Intergenic
1140423258 16:74838716-74838738 CAAGAAACACAAACTGAGAATGG + Intergenic
1140612757 16:76621013-76621035 TAGAAAACACAAATTGAGCATGG - Intronic
1140959825 16:79901027-79901049 CAAGAAATACAAAAAGAGCAAGG - Intergenic
1141368922 16:83469444-83469466 CAGGAAAAACATATTGAGGCTGG + Intronic
1143173740 17:4944938-4944960 CAGGAAAAACAAGGGGAGCTGGG - Exonic
1144146236 17:12401246-12401268 CAGGATAAACAAAAGGAGAAAGG + Intergenic
1144654281 17:17025382-17025404 CAGGAAACACCAATAGAGGAGGG + Intergenic
1149215546 17:54349719-54349741 CAGGAGTAACAAATTAACCAAGG + Intergenic
1149396164 17:56246532-56246554 CAGGGAAAAAAAATTGCACAAGG - Intronic
1150178965 17:63094405-63094427 CAGGAAAAAAATATATAGCATGG - Intronic
1150428053 17:65093087-65093109 CAAGAAAAACAAATTAAATATGG + Intergenic
1150661124 17:67080481-67080503 CAGGAAGAGCAGACTGAGCATGG - Intronic
1152103358 17:78315427-78315449 CAACAAACACAAACTGAGCATGG + Intergenic
1152523008 17:80871363-80871385 CAGGACAAAAACATTGGGCATGG - Intronic
1152986233 18:323950-323972 CTGGAAAAACAAATGGAGAAAGG - Intronic
1153050689 18:900803-900825 CAGGAAAAACAATTCGGGGAAGG + Intergenic
1153469443 18:5427648-5427670 CAGGACAAACAGAAAGAGCATGG + Intronic
1153708115 18:7768330-7768352 AAGGAAAAAAAAATTTAGCTAGG + Intronic
1154102477 18:11489069-11489091 CAGAAAAAAAAAATTGATAAAGG - Intergenic
1156040915 18:32821958-32821980 AAGGTAAACCAAATTGAGGAAGG - Intergenic
1156663363 18:39375607-39375629 CAGGAAAAACAAGTTAACCAGGG - Intergenic
1156743938 18:40366698-40366720 CAGGAAAAGCAACTTGCCCAAGG + Intergenic
1157740400 18:50087831-50087853 CAGGAAAACCAAGATGAGAAAGG + Intronic
1157814564 18:50721448-50721470 CAGGAATAACAAATTGGGTTTGG - Intronic
1157986344 18:52442533-52442555 CAGGACATACAAAATGATCAAGG + Intronic
1159245637 18:65800980-65801002 CAGGAAAACCAAGCTGAGCCCGG - Intronic
1159718535 18:71856356-71856378 CAAGCAAATCAAATTCAGCAAGG + Intergenic
1160555899 18:79724969-79724991 CAGGAAATCCAACTTGATCAAGG - Intronic
1161534792 19:4812225-4812247 CAGGAGAAAGAATTTCAGCAGGG - Intergenic
1162845682 19:13390648-13390670 CATAAAAAAAAAATTGATCAGGG - Intronic
1163068905 19:14821296-14821318 CAGGAATAACAATTAGATCAGGG + Intronic
1163894815 19:20049452-20049474 CAGGAAAAACTAGTGGAGGATGG + Intergenic
1165177350 19:33939970-33939992 AAGTAAAAACAAAATTAGCAAGG - Intergenic
1165398222 19:35579389-35579411 CAGGAAAAATTAACTGGGCATGG + Intergenic
1166148220 19:40851526-40851548 CAGGAAAACCAAATCCAGAAAGG - Intronic
1166152362 19:40883311-40883333 CAGGAAAACCAAATCCAGAAAGG - Intronic
1166910397 19:46150828-46150850 TATGAAAAACAAAATTAGCATGG - Intronic
1167047913 19:47061973-47061995 CAGAAAAAACAAATTTAGCCAGG - Intergenic
925292907 2:2760251-2760273 CAGAAAAAATAAAGTGACCATGG + Intergenic
925717560 2:6798258-6798280 CAGGAAAAGCAAAATGAGGAGGG + Intergenic
926544396 2:14221257-14221279 CAGGAAAAGCAATTTAAACATGG + Intergenic
926588388 2:14714314-14714336 CACAAAAAACAAACTGAGAAGGG + Intergenic
926706226 2:15839667-15839689 CAGGATAAACAAATGGTGCATGG + Intergenic
926861826 2:17317859-17317881 TGGGAAAAACAAACTGAACAGGG + Intergenic
928288343 2:30013679-30013701 CAGCAAAAACAAATAATGCAGGG + Intergenic
928465836 2:31521471-31521493 AAAGAAAAACAACTTGACCAGGG - Intergenic
928953697 2:36839229-36839251 GAGGGAAAAAAAATAGAGCAGGG - Intergenic
929120648 2:38481372-38481394 CAAGAAAAACAGATAGAGGAAGG + Intergenic
929121854 2:38490046-38490068 AAGTAAAAACAAATTCAACAAGG + Intergenic
930293485 2:49525342-49525364 CAGATAAAACAAATTGAAAAGGG + Intergenic
931298588 2:60954912-60954934 AGTGAAAAACAAAGTGAGCAAGG - Intronic
931594411 2:63926085-63926107 CAAGCAAAACAAAGTAAGCAAGG + Intronic
931662257 2:64576748-64576770 CAACAAAAAAAAAGTGAGCATGG - Intronic
931816725 2:65910919-65910941 AGGGAAAAAGAAATTAAGCAGGG - Intergenic
931922772 2:67038658-67038680 AATGAAAAACAAATTTAGAAAGG - Intergenic
932279841 2:70481080-70481102 GAGGAAAAACAAATTTTTCATGG - Intronic
933373060 2:81441921-81441943 GAGAAAAAATAAATTGAGCTGGG - Intergenic
933701807 2:85260478-85260500 CAGGAAAAAAAAAATTAGCAGGG + Intronic
934625627 2:95848142-95848164 AAGGAAAAACAGAATGAGAAGGG + Intronic
934807944 2:97253174-97253196 AAGGAAAAACAGAATGAGAAGGG - Intronic
934829566 2:97504013-97504035 AAGGAAAAACAGAATGAGAAGGG + Intronic
935653294 2:105399653-105399675 CGGGAAAACCAAAGTGAGCTGGG + Intronic
936736390 2:115447650-115447672 CAGGAAAGACCAAGAGAGCAGGG - Intronic
939041582 2:137195448-137195470 CAGAAAAAACAAGATGAGCTTGG + Intronic
939046734 2:137258658-137258680 CAGAAAAAAAAAAAAGAGCATGG - Intronic
939478635 2:142718985-142719007 CATGAGAAAAAAATTGAACATGG + Intergenic
939511901 2:143117366-143117388 CAGGAAAGAGAAAGAGAGCAGGG + Intronic
940065731 2:149626244-149626266 CAGGAAAGACTAATTAAACAAGG + Intergenic
940306626 2:152233931-152233953 CAGAAAAACCATATTGAGCAAGG - Intergenic
940518958 2:154718105-154718127 CAGGAAAAACTAATGGCACATGG + Intronic
940553609 2:155193738-155193760 CAGGAAGAGCAGATTGAGCAAGG - Intergenic
941405500 2:165082855-165082877 AAGGAAAAGCAATCTGAGCAGGG - Intergenic
941474145 2:165927459-165927481 CAGGAGAAAATAATAGAGCATGG - Intronic
942267670 2:174244715-174244737 CAGGAGAAACAGCTTGAGCCCGG - Intronic
943265150 2:185720928-185720950 CAGGAAATAAAAATTGAGTTTGG - Intergenic
943454789 2:188092079-188092101 CAAGAAAAAAGAATTGAGAAGGG + Intergenic
943525877 2:189016807-189016829 AAGGAAAAACAAAGTGAATATGG + Intergenic
943829644 2:192443959-192443981 CAGGAAAAACAAATCAAACTTGG + Intergenic
943989233 2:194665541-194665563 CAAGAAAAAGAAATAAAGCAAGG + Intergenic
944225293 2:197343512-197343534 CAGGAAAAAAAAATTTAGGCAGG - Intergenic
944826997 2:203494160-203494182 AAGGAAAAGCAAAGTGGGCAAGG - Intronic
945253733 2:207786392-207786414 CAGAAAAAAAAAAAGGAGCATGG + Intergenic
945692864 2:213063419-213063441 CAGGATAAACAAATTTCCCAAGG - Intronic
945847342 2:214962112-214962134 ATGGAAAAACAATTTGCGCAAGG + Intronic
946034287 2:216729517-216729539 AAGGAAAGATAAATTGGGCAGGG + Intergenic
946080552 2:217114815-217114837 CAGAAAACACAAATTTATCAAGG - Intergenic
946645991 2:221834731-221834753 CAGAAACAAAGAATTGAGCAAGG + Intergenic
1168872291 20:1140245-1140267 TAGGATAAACATATAGAGCAAGG + Intronic
1169551567 20:6706900-6706922 CAGGAAAATAAAAATCAGCATGG - Intergenic
1169603989 20:7294596-7294618 AAGGAGATACAAACTGAGCAGGG - Intergenic
1169945695 20:10985685-10985707 CAGGGAAAAGAAATAGAGGACGG - Intergenic
1170982331 20:21226446-21226468 CAGGAAAAACAAAATTAATAAGG - Intronic
1171720486 20:28557600-28557622 CAGGGAATACAGATTGTGCATGG - Intergenic
1171784803 20:29453049-29453071 CAGGGAATACAGATTGTGCATGG - Intergenic
1171863585 20:30424590-30424612 CAGGGAATACAGATTGTGCATGG + Intergenic
1172477800 20:35252059-35252081 CAGGAAAAACAGAGTGAGGGTGG - Intronic
1172625895 20:36346541-36346563 CAGGAAAAACAGGTTGTGCCTGG + Intronic
1173046251 20:39515642-39515664 GAGACAAAACAAATTGAGAAAGG + Intergenic
1173639393 20:44589845-44589867 CAGGAAAAAGAAATTAAACCAGG + Exonic
1173916679 20:46713285-46713307 CAGAAAAAACAAGTGGAGAAGGG + Intronic
1173954113 20:47017543-47017565 CAGGAAAAAAAAATTGTGAAAGG + Intronic
1174077435 20:47948012-47948034 CAGGAAAAAAAAGCTAAGCAAGG + Intergenic
1174942755 20:54948909-54948931 CAGGAAAAAAAAATTGGGGGGGG - Intergenic
1175768802 20:61609816-61609838 CAGGAAAAACAAATTTTAAATGG - Intronic
1176065875 20:63194458-63194480 AAGGAAACACAAAATGAGAACGG - Intergenic
1177014129 21:15762743-15762765 AAGGAAAAAGAACTTGAGAAAGG - Intronic
1177976216 21:27854333-27854355 CAGGAAAAAGAGCTTGTGCAGGG - Intergenic
1178083004 21:29085009-29085031 AAGGAAAAAAAAAGTCAGCAAGG + Intronic
1178151925 21:29805020-29805042 AAGGAAAAACAAATAGAGGCTGG - Intronic
1178257077 21:31063863-31063885 CAGGAAAAATACGTTGACCACGG + Intergenic
1178527101 21:33340042-33340064 CATGAAAAATAAAGTGGGCATGG - Intronic
1178535727 21:33408834-33408856 GAGGAAGAACAAACTGAGCTGGG + Intronic
1179590418 21:42404322-42404344 CAGCCAACACAAATTGAACAGGG - Intronic
1181794870 22:25299838-25299860 CAGGATAAACAAACTAATCAAGG - Intergenic
1181835437 22:25603487-25603509 CAGGATAAACAAACTAATCAAGG - Intronic
1182483653 22:30626437-30626459 CTGCAGAAACAGATTGAGCAAGG - Intronic
1182822881 22:33233866-33233888 CAGGAAGAACCAATTGAAGATGG - Intronic
1184237215 22:43189322-43189344 CAGGATTTACAAAGTGAGCATGG - Intergenic
1184334732 22:43846442-43846464 CAGGAAATATGAATTGAGCATGG - Intronic
1184707799 22:46226880-46226902 AAGAAAAAAAAAGTTGAGCAAGG + Intronic
949237414 3:1826652-1826674 CAGGGAAAACACATAGAACAGGG - Intergenic
950130762 3:10544871-10544893 GAGGAAAAACAAATTCTGGAAGG - Intronic
950134849 3:10573835-10573857 GAGGAAAAGCAAATTGAAGAAGG - Intronic
951707880 3:25561997-25562019 CAGGGTAAAAAAGTTGAGCAGGG - Intronic
951848682 3:27113837-27113859 CAAGAAAAACTAAGTGTGCAAGG - Intronic
952209900 3:31219874-31219896 CAACAAATACAAATTGAGCCAGG + Intergenic
953591463 3:44259430-44259452 AAGGAAAAACATCTTAAGCAAGG - Intronic
953703009 3:45211138-45211160 CAGGAAAAACCACTTGGGGAGGG + Intergenic
953712769 3:45288648-45288670 GAGGAAAAACAAATTCCGCTGGG - Intergenic
954122877 3:48510504-48510526 CAGGAAAAACTGAGTGAGCCTGG - Intergenic
954172317 3:48814616-48814638 CTGGAAATACAAATGGAACAAGG - Intronic
954758918 3:52860257-52860279 GAGGAATAACATATGGAGCATGG + Intronic
955851202 3:63222002-63222024 AAAAAAAAAAAAATTGAGCATGG - Intergenic
955900531 3:63748949-63748971 CAGGAAAAGCAAATGTAGAATGG - Intergenic
956143201 3:66166383-66166405 GAGGAAAAAGAAATGCAGCAAGG - Intronic
956578446 3:70781946-70781968 CAGGAAACTCAAACTTAGCATGG - Intergenic
957357753 3:79114067-79114089 CAGGAAAGACAGCTTGTGCAGGG - Intronic
957573739 3:81983102-81983124 CAGGAAAAACACATTGAAGAGGG - Intergenic
957649744 3:82984345-82984367 AAGTAAAAAAAAATTGAGGAAGG - Intergenic
957711663 3:83867945-83867967 CAAGAAAAAAAAATTTAGAAGGG + Intergenic
957712580 3:83881338-83881360 CCTGAAAAAAAAATTTAGCAAGG + Intergenic
958687223 3:97414178-97414200 TAGGAAAATTAAATTGAGAAAGG + Intronic
959296731 3:104544835-104544857 CAGGAAGAACAAAATGAGAAAGG - Intergenic
959472749 3:106773089-106773111 CAGGAAAGACAAATTTGGTAGGG + Intergenic
960166618 3:114410034-114410056 CAGGAAAAATAAATTAGGGAGGG + Intronic
960241762 3:115350895-115350917 CAGGAAAAAAAAATTAAAAAAGG - Intergenic
961888252 3:130110755-130110777 CATGAATTACAAATGGAGCAGGG + Intronic
962130165 3:132664083-132664105 CAGGAAAAACAAACCAAACAAGG + Intronic
962224915 3:133597737-133597759 AAGAAAAAAAAAATTGAGCTGGG + Intergenic
963399849 3:144784270-144784292 CACTAAAAACTAATTCAGCATGG - Intergenic
963638020 3:147823876-147823898 GTGGCAAAACAAAGTGAGCAAGG - Intergenic
963702163 3:148639919-148639941 CAGGAAACACAACTTTAACATGG + Intergenic
963744536 3:149113078-149113100 CAGGCAAAACAAAATGATCTTGG - Intergenic
963836612 3:150063954-150063976 CAGGAAGAAGAAAATGAACAAGG - Intergenic
964130142 3:153277539-153277561 CACCAAAACCAAAATGAGCAGGG - Intergenic
964602924 3:158522720-158522742 CAGGGAAAAAAAATGAAGCATGG - Intronic
964716970 3:159732674-159732696 CAGGGGAAACAAATTCAGCTGGG + Intronic
964775726 3:160274637-160274659 CAGTAAAAACAACATAAGCATGG + Intronic
965007264 3:163042557-163042579 AATGAAAAAATAATTGAGCATGG - Intergenic
965499439 3:169440469-169440491 CAGGAGAAACCCAATGAGCAAGG + Intronic
965597846 3:170425524-170425546 AAAGAAAAACAAATTCAGCTAGG - Intronic
966346754 3:178989379-178989401 CAGGAAAGACAGAGAGAGCAGGG + Intergenic
966572093 3:181455095-181455117 CAGGAAAAAAAAAAAAAGCATGG + Intergenic
970496187 4:16628513-16628535 CAGGCAAAAAAAGTTGAGAAGGG - Intronic
970746907 4:19309633-19309655 CAGGAAACACCAATTTAGCATGG - Intergenic
970789088 4:19835325-19835347 CAGGCAAAAAAACTTGTGCAGGG - Intergenic
971148790 4:24008783-24008805 AAGGAAAAACAAAATTAACAGGG - Intergenic
972583672 4:40417373-40417395 CAGGAAAAAAAAATGTAGAAAGG + Intergenic
972990505 4:44817799-44817821 CAGAAAAAAAAAACTGAGGAAGG - Intergenic
973026658 4:45282276-45282298 AATGAAAAATAAATAGAGCAAGG + Intergenic
973657125 4:53059607-53059629 CAGGAAAAAAAAAAAGAGAAAGG - Intronic
973741942 4:53926747-53926769 AAGGAAAATCAACTTCAGCAAGG + Intronic
974165743 4:58199249-58199271 CAGGAAAAATAAATTATCCATGG - Intergenic
974191573 4:58511006-58511028 CCCAAAAAACAAATTAAGCAAGG - Intergenic
974692764 4:65320458-65320480 TAGGAAAAACAAAATGAGAAAGG + Exonic
974875341 4:67697557-67697579 CAGGAAGAATAGATTAAGCAGGG - Intronic
976408235 4:84683586-84683608 TAGGGAAAACATAGTGAGCAGGG - Intronic
976633375 4:87262760-87262782 CATTAAAAACAAGCTGAGCACGG + Intergenic
976747376 4:88417384-88417406 TAGGAAAAACATATTTATCATGG + Intronic
976836048 4:89375167-89375189 AAGGAAAATCAAGTTGAGAATGG - Intergenic
977078929 4:92497712-92497734 CTGGAAAAAAAGATTGTGCAGGG - Intronic
978987427 4:115030706-115030728 TAGGAAAAACAAATTCAGTTTGG + Intronic
980432675 4:132724984-132725006 AAGGAAAAACAAATTGTCAAGGG - Intergenic
980651927 4:135727747-135727769 CATGAAAGACCAAGTGAGCATGG - Intergenic
980667959 4:135963314-135963336 GAGGAAAAACAAATTGAAATTGG + Intergenic
981145359 4:141317621-141317643 CTGGAGAAACAAAGTGTGCAAGG + Intergenic
981236841 4:142426917-142426939 TAGGAAAAAGAAATTCAGTAAGG - Intronic
981251836 4:142612123-142612145 CAGGAGAAAAAAATAGAGGAAGG + Intronic
981863283 4:149382576-149382598 CAGGAAAAAAAAAATGCCCAGGG - Intergenic
983245216 4:165279869-165279891 CAGGAGAAACAAAATACGCAGGG - Intronic
983353653 4:166628036-166628058 CAAAAAATACAAATTTAGCAGGG + Intergenic
983890120 4:173021898-173021920 CAGGAGAATCACTTTGAGCATGG + Intronic
984507787 4:180641228-180641250 CAGGAAAAACAGACTGGTCAAGG - Intergenic
984724960 4:183011939-183011961 GAGCAAAAAAAAATTCAGCACGG + Intergenic
984732727 4:183083587-183083609 CAAAAAAAAAAAATTGAGTAGGG - Intergenic
985309696 4:188583731-188583753 CTGAAAACACAAAATGAGCAGGG - Intergenic
985446625 4:190025019-190025041 CAGGAAAAAAAAAATTAGCCAGG + Exonic
985550321 5:529514-529536 TAGGAAAAAAAAATCTAGCAAGG + Intergenic
985877190 5:2609144-2609166 CAGTGAAAACAAAATGAGCTAGG + Intergenic
987270592 5:16304484-16304506 CAGGAATACCAGAATGAGCAAGG + Intergenic
987681845 5:21145834-21145856 CAGGAGAAAGAATTTGACCAAGG - Intergenic
989045845 5:37272645-37272667 CAGGAGAAAAAAGTTGAGCTGGG + Intergenic
989668410 5:43884833-43884855 AAGGAAAAACAAAATGGCCATGG - Intergenic
990297038 5:54412730-54412752 CAGGCAAAACCAATTCAACATGG + Intergenic
990440334 5:55838595-55838617 CTTAAAAAAAAAATTGAGCAAGG + Intergenic
991315818 5:65304752-65304774 CAGCAAAAAAAAATTAAGAAAGG + Intronic
991340538 5:65603433-65603455 CAGGAAAAAAAAAGTGTGTAAGG + Intronic
991477504 5:67038533-67038555 CAAGAAAACCAAATTGATGATGG + Intronic
991666772 5:69007105-69007127 AAGGAAAAAGAAATTGAAAAAGG - Intergenic
991912465 5:71575258-71575280 CTGGAAAAACAAATAGAAAAGGG + Intergenic
992279112 5:75155184-75155206 CAGGAAAAAATAATAGAACAGGG - Intronic
992399825 5:76402408-76402430 CAGGAAAAACAAACTGAGGGAGG - Intergenic
992513594 5:77468098-77468120 CATGAAAAACAAGTTCAACAAGG + Intronic
992570320 5:78048738-78048760 CAGAGAAAACAACTTCAGCAAGG - Intronic
992872018 5:81016539-81016561 CAGGAAAAACACATTCAGTCTGG - Intronic
993222385 5:85116875-85116897 CAGGCAAGACAACTTGTGCAAGG - Intergenic
993384658 5:87250775-87250797 AGGGAAAAGCAAATTGAGGAAGG - Intergenic
993594684 5:89838574-89838596 CAGGAGAAACAAAGTTAGGATGG + Intergenic
993878973 5:93341198-93341220 CCTGAAAAACAAATTCTGCAAGG - Intergenic
994468135 5:100164949-100164971 CAGGAAAAGAAAAGGGAGCATGG + Intergenic
994735529 5:103549601-103549623 AAGGAAAAAGAAATTGTGAAAGG - Exonic
995026815 5:107433320-107433342 TAGGAAAATAAAATTCAGCATGG + Intronic
995756807 5:115514135-115514157 CAGTAACAACAAAATGAGGATGG + Intergenic
995798811 5:115969258-115969280 CAGGAAAAAAAAATTAATAATGG - Intronic
995918705 5:117284142-117284164 CAGGAGAAGCAGATTGAACACGG - Intergenic
996751988 5:126897844-126897866 CAGAAATAAAAAATTTAGCAAGG + Intronic
997466026 5:134088692-134088714 CAGGATCAAGAAATAGAGCATGG + Intergenic
998526728 5:142849538-142849560 CAGGACAAAGAAGGTGAGCAAGG - Intronic
998544504 5:143015155-143015177 CAAAAAAAATAAAATGAGCAAGG + Intronic
1000412893 5:160952203-160952225 CAGGAAAATCAAGTGGAGGAGGG + Intergenic
1000585420 5:163091572-163091594 CAGGGAAAACAACTTTATCAAGG - Intergenic
1000724146 5:164747505-164747527 GAGGAACAACTAATTAAGCAGGG + Intergenic
1002828699 6:798525-798547 CAGGAAAAATGAATGGAGAAAGG - Intergenic
1002846150 6:947259-947281 GAGGAAAAACTCATTGAGAAGGG + Intergenic
1003411640 6:5868782-5868804 CAGTCAAAACAGATTGACCAAGG + Intergenic
1003690683 6:8350859-8350881 CAAAAAAAAAAAATGGAGCAGGG - Intergenic
1004074566 6:12333025-12333047 CATTAAAAACAAATTCAGTATGG + Intergenic
1004344480 6:14835943-14835965 AAGGAAAAAAAAATTGTCCAAGG - Intergenic
1004824910 6:19408928-19408950 CAGTAAAAACAAATTCAGCATGG - Intergenic
1005569678 6:27132781-27132803 AAGGAAAAACAGCGTGAGCAGGG + Intergenic
1005607959 6:27494380-27494402 CAGGTAAAACAAATGAATCAGGG - Intergenic
1005671465 6:28110166-28110188 CAGGAAAGAGAAAGTGCGCAAGG - Intergenic
1007512511 6:42384958-42384980 TAGAAAAAACTAGTTGAGCATGG - Intronic
1009038965 6:58154698-58154720 AAAGAAAAAAAAATTGAGCTGGG - Intergenic
1009214861 6:60909534-60909556 AAAGAAAAAAAAATTGAGCTGGG - Intergenic
1009825967 6:68866317-68866339 CAGGAGAAAGAAAGGGAGCAAGG - Intronic
1010416557 6:75618090-75618112 GAGGAAAAACAAACTGACAATGG - Intronic
1010849379 6:80752899-80752921 TAGGAAATACAAAATGAGAAGGG - Intergenic
1011243964 6:85302143-85302165 CAGGACAAACTGAGTGAGCATGG + Intergenic
1012023813 6:93962516-93962538 CAGAAAGGACAAATTGAGAAGGG + Intergenic
1012353215 6:98279058-98279080 CAGGAAAAGCCAATAGAGAAGGG - Intergenic
1013737738 6:113247806-113247828 AAGAAAAAACAAATTGAGTTAGG - Intergenic
1014101071 6:117512509-117512531 CATCAAAAACAAATTGAAAATGG + Intronic
1014125217 6:117769406-117769428 CAGGAAAAACTATTTGAACATGG - Intergenic
1014705415 6:124740486-124740508 TATGAAAAAAAAACTGAGCATGG + Intronic
1016837989 6:148498248-148498270 CAAAAAAAACAAATTTAGCTGGG + Intronic
1017300654 6:152853951-152853973 TAGCAAAAACAAATTTAGCCTGG - Intergenic
1017401533 6:154069950-154069972 AAGGAAAAACAAATGAAGTAGGG + Intronic
1018006937 6:159631108-159631130 CAGGAAAAACACAATGGGGAAGG + Intergenic
1018161293 6:161045263-161045285 AAGGAAAAGCAAATTGGGAAAGG - Intronic
1018177176 6:161187065-161187087 CAGATAAAACAAAGTCAGCAAGG - Intronic
1018217596 6:161545213-161545235 AGGGAAAAAAAAATTAAGCACGG + Intronic
1019849792 7:3543306-3543328 CATGAAACAGAAATTAAGCAAGG - Intronic
1020048917 7:5068251-5068273 CATTAAAAAAAAAATGAGCATGG + Exonic
1020395108 7:7706395-7706417 CAGGAAATACCAACAGAGCATGG + Intronic
1020904264 7:14045390-14045412 AAGGGAAAATAACTTGAGCATGG - Intergenic
1021059991 7:16099457-16099479 CAGGAAAAACATAAGGAGAAGGG + Intronic
1021191757 7:17628507-17628529 CAGGAGAAGCAAATTGAAAATGG + Intergenic
1021885733 7:25136812-25136834 AAGGAGAAAAAAATTGATCAGGG + Intronic
1023480745 7:40631388-40631410 CAGGAAAAACAAATGTCACATGG - Intronic
1024785574 7:52903491-52903513 CAGTAAAAAAAAAATGACCAAGG + Intergenic
1025205718 7:56992402-56992424 GAGGAAAAACCACTTGGGCAGGG - Intergenic
1025666222 7:63584536-63584558 GAGGAAAAACCACTTGGGCAGGG + Intergenic
1026198282 7:68191992-68192014 GAGGTTAAACAAATTGATCAAGG - Intergenic
1026263696 7:68777787-68777809 AAAGAAAAACAAATTGAGCCTGG + Intergenic
1027429026 7:78090513-78090535 TAGGAAAACCATAGTGAGCAAGG - Intronic
1027634754 7:80657295-80657317 TAGGAAAAATGAATTTAGCACGG - Intronic
1027758268 7:82244607-82244629 AAGGAAAATAAAATTAAGCAAGG + Intronic
1027886687 7:83916763-83916785 CAGGAAAGACTTCTTGAGCATGG + Intergenic
1028060790 7:86312337-86312359 CAGGAAAAAGAAAATTGGCAGGG - Intergenic
1028760904 7:94495396-94495418 CATTAAAAAAAAATAGAGCAAGG + Intergenic
1029793658 7:102871544-102871566 CAGAAAAAAAAAATTTAGCCAGG - Intronic
1030042651 7:105465854-105465876 AAGGAAAAAGAAATTAAGCTGGG + Intronic
1030230007 7:107197883-107197905 CAGGAAAAACAAATTGAGCAAGG - Intronic
1030478075 7:110062867-110062889 CAGTAAAAATACATGGAGCAAGG - Intergenic
1030754805 7:113274177-113274199 CAGGAAAGAGAGAATGAGCAAGG + Intergenic
1030854413 7:114535213-114535235 CAGGACAAACATAGTGAGTAAGG - Intronic
1031023674 7:116656277-116656299 TAGGAAAAACAACCTGAGGATGG - Intergenic
1031351667 7:120739628-120739650 CAGGAAGAATAAATTTAGGAAGG + Intronic
1031614108 7:123860859-123860881 CAGGATAAGAAATTTGAGCAAGG - Intronic
1032200129 7:129815248-129815270 CAAAAAAAAAAAATTGAGAAAGG + Intergenic
1032803471 7:135334931-135334953 CAGGAAAAATAAACTGACCTTGG + Intergenic
1033398150 7:140995019-140995041 CAGGAAAAAAAAATTGACACAGG - Intergenic
1033979452 7:147146141-147146163 CATGAGAAAAAAATTGAGCGGGG + Intronic
1034453140 7:151148602-151148624 CAGCACCAACAAATGGAGCAGGG - Exonic
1035487885 7:159242472-159242494 CAGCAAAAACAAATTTAACTTGG + Intergenic
1035518969 8:261122-261144 CAGGAAAATCCAATGGAGCCAGG - Intergenic
1035733665 8:1871904-1871926 CAGGAAAAAAATAATGGGCAAGG + Intronic
1036078419 8:5526102-5526124 AAGGAAAAACAAAGTAAGAAAGG - Intergenic
1038900454 8:31837200-31837222 CATGAAAAACAAAGTGAAAAAGG - Intronic
1040110914 8:43566868-43566890 CCGGAAAAAAAAATGCAGCAAGG - Intergenic
1040385013 8:46909204-46909226 CAGGAAGATGAAATTGAACAGGG + Intergenic
1041269376 8:56096102-56096124 CAGCAAAAAGGAGTTGAGCATGG - Intergenic
1041351097 8:56948264-56948286 CAGGAGAAAGAATTTGACCAAGG - Intergenic
1041429905 8:57767617-57767639 CAGGAAACATAAAATGGGCATGG + Intergenic
1043067183 8:75589763-75589785 CAACAAAAACAAATTGTGGAGGG - Intergenic
1043638711 8:82421014-82421036 CAGGTAAGACAAATTAAACATGG - Intergenic
1044130216 8:88513195-88513217 CAGGAAAGAGAACTTGTGCAGGG - Intergenic
1044234771 8:89818387-89818409 CTGAGAAAACAAATTTAGCATGG - Intergenic
1044392735 8:91670847-91670869 CAGGAAAGATAAATTGAAGAGGG + Intergenic
1044835213 8:96288928-96288950 AAAGAAAAAAAAATTGATCATGG - Intronic
1044927290 8:97220415-97220437 GAGGAAAAATAAATTGTACATGG - Intergenic
1045134208 8:99195716-99195738 GAGGAAAAACCAATTCAGAAGGG - Intronic
1045207275 8:100055708-100055730 CAGGCAAAAGAACTTGTGCAGGG - Intronic
1046037150 8:108856742-108856764 CAGGAAAAACAAACTCAAAATGG + Intergenic
1046196939 8:110877711-110877733 AAAGAAAAACAAATTGAGGCAGG + Intergenic
1046372807 8:113332413-113332435 AATGAAAAACAAATTCAGCAAGG + Intronic
1046771077 8:118117049-118117071 CTGGAAAAGGAAATTAAGCAAGG - Intergenic
1046774350 8:118147892-118147914 CAGAAAAAAAAAATTCAGCAAGG - Intergenic
1047039020 8:120971881-120971903 AATGAAAAGCAAATAGAGCAAGG - Intergenic
1047192926 8:122694798-122694820 CAGTAAAAAAAAATTAAACATGG + Intergenic
1047223560 8:122938221-122938243 CAGGAAACATAAACTGGGCATGG - Intronic
1048418111 8:134249666-134249688 TAGGAATGACAAATTCAGCAGGG - Intergenic
1049520888 8:143089837-143089859 CAGGAAAATCTCAATGAGCAAGG + Intergenic
1049579266 8:143404022-143404044 AAGGAAAAACAAAGGGAACATGG + Intergenic
1049837863 8:144750502-144750524 CAGGAGAAACAATTTTACCAGGG - Intronic
1050228152 9:3485223-3485245 TAGGAAAAACCAATAGAACAGGG - Intronic
1050247558 9:3706923-3706945 CAGGGAGAACAGGTTGAGCACGG + Intergenic
1050253824 9:3773409-3773431 CTGCAGCAACAAATTGAGCAAGG - Intergenic
1051466102 9:17379896-17379918 CAGTAAAGAGAAATTTAGCATGG - Intronic
1052464516 9:28813599-28813621 CAGGAGACACACATTGAACAAGG + Intergenic
1052667535 9:31514225-31514247 CAGGAAAAACAGGTTGGGCATGG - Intergenic
1053028220 9:34749559-34749581 CAGAAAAAAAAAATTGAGACAGG - Intergenic
1055972713 9:81927868-81927890 CAAAAAAATCAAATTGGGCAGGG + Intergenic
1055974466 9:81942940-81942962 CAAAAAAATCAAATTGGGCAGGG + Intergenic
1056225844 9:84494235-84494257 AAGGAAAAACAAGCTGTGCATGG + Intergenic
1057974455 9:99589990-99590012 GAGGAAGAACAAATTGCACAGGG + Intergenic
1058452477 9:105110062-105110084 CAGGAAAAGCAAGGTCAGCATGG + Intergenic
1059135227 9:111799682-111799704 CAGCTGAAACAATTTGAGCAGGG - Intergenic
1059375462 9:113876894-113876916 TAGAAAAAAAAAATTGAGAAAGG - Intronic
1060040343 9:120294973-120294995 CAGGAAAAACAAAAAGACCCAGG + Intergenic
1060620552 9:125061891-125061913 TAGGAAAAAAATATAGAGCAAGG + Intronic
1061320569 9:129825799-129825821 CAGGAAATACAAGATGAGCCCGG - Intergenic
1062211973 9:135369931-135369953 GAGGAAACACCAATTAAGCAAGG + Intergenic
1203445593 Un_GL000219v1:52219-52241 CAGGGAATACAGATTGTGCATGG - Intergenic
1186861442 X:13676160-13676182 CAGGCAAAACAATTTGAGAGTGG + Intronic
1187562168 X:20413152-20413174 CAGGAAGAACAAAATGAGACAGG - Intergenic
1187667139 X:21626725-21626747 CAGAAAACACAAATTTAGAATGG + Intronic
1188097139 X:26037426-26037448 TAGGAAAAACAGATTGATTATGG - Intergenic
1188949294 X:36349175-36349197 CAGGCAAGACAGGTTGAGCATGG - Intronic
1189501980 X:41569617-41569639 CAGGGAAAAAAAATTAAGGAAGG + Intronic
1189540807 X:41986273-41986295 CACTAACAACAAATTGAGAAAGG + Intergenic
1190722432 X:53161099-53161121 CTGGAAAAACAAATAAAGAAGGG - Intergenic
1193216504 X:78870597-78870619 CAGGAAAAACATTTTGTGGAGGG + Intergenic
1193336251 X:80293355-80293377 CAGGAAGTAAAAATAGAGCAGGG + Intergenic
1195105252 X:101597297-101597319 CAAGAAAAACAAAAAGAGCGTGG + Intergenic
1195449960 X:105000044-105000066 GAGGAAAAAGAAGTTGAGGAAGG - Intronic
1196154654 X:112415196-112415218 GAGGAAAAAGTAATTGAGAAGGG - Intergenic
1196404675 X:115348707-115348729 CAGGGAAAACAAACTGAAAAAGG - Intergenic
1196981414 X:121217916-121217938 CAAGAAAAACAAAGTGTACAGGG + Intergenic
1197030966 X:121815329-121815351 AAGGAAAAACACATAGAGAAGGG - Intergenic
1197600840 X:128526804-128526826 AATGAAAAACAAAAAGAGCAGGG + Intergenic
1197861480 X:130975603-130975625 AAGGAAATATAAATTAAGCATGG + Intergenic
1198458444 X:136839943-136839965 AAGATAAAACAAATTGAGCCAGG - Intergenic
1198460861 X:136861758-136861780 AAGTAAAAACAAAATGAGGAGGG + Intronic
1198715182 X:139551111-139551133 CAGGAAAAACAGTCTCAGCACGG - Exonic
1199458844 X:148060367-148060389 CAGGCAAAAGAGCTTGAGCAGGG + Intergenic
1200832611 Y:7702150-7702172 GAGGAGAAAAAAATGGAGCAAGG + Intergenic
1201742409 Y:17337955-17337977 AAGCAAAAAGAAAATGAGCAAGG + Intergenic
1202336850 Y:23820954-23820976 CAGGGAAAACAAACTGCACAGGG + Intergenic
1202533915 Y:25849117-25849139 CAGGGAAAACAAACTGCACAGGG - Intergenic