ID: 1030230315

View in Genome Browser
Species Human (GRCh38)
Location 7:107201821-107201843
Sequence ATACAGATTAATAAGCAGTA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 267
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 247}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030230315_1030230317 9 Left 1030230315 7:107201821-107201843 CCTTACTGCTTATTAATCTGTAT 0: 1
1: 0
2: 1
3: 18
4: 247
Right 1030230317 7:107201853-107201875 GATGAAATGAAGCAGAAGCTGGG 0: 1
1: 0
2: 2
3: 33
4: 315
1030230315_1030230318 15 Left 1030230315 7:107201821-107201843 CCTTACTGCTTATTAATCTGTAT 0: 1
1: 0
2: 1
3: 18
4: 247
Right 1030230318 7:107201859-107201881 ATGAAGCAGAAGCTGGGAGTCGG 0: 1
1: 0
2: 1
3: 35
4: 462
1030230315_1030230316 8 Left 1030230315 7:107201821-107201843 CCTTACTGCTTATTAATCTGTAT 0: 1
1: 0
2: 1
3: 18
4: 247
Right 1030230316 7:107201852-107201874 TGATGAAATGAAGCAGAAGCTGG 0: 1
1: 0
2: 3
3: 38
4: 384

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030230315 Original CRISPR ATACAGATTAATAAGCAGTA AGG (reversed) Exonic
904759424 1:32791423-32791445 ATACTGATAGAAAAGCAGTAGGG - Intronic
906766256 1:48437266-48437288 ATACAGAAGAAAAAGCAGCAAGG - Intronic
906982193 1:50643388-50643410 AAAAAAATTAATAAGCAATATGG - Intronic
907661741 1:56399635-56399657 ATACAGATAAGTAAGAAGTGAGG + Intergenic
908166104 1:61460816-61460838 ATACAGTTCACTAAGCATTATGG - Intronic
909755606 1:79221456-79221478 TTACAGACTAATAGGCAGTAGGG + Intergenic
909994468 1:82262034-82262056 ATATATATAAATATGCAGTATGG + Intergenic
910334869 1:86116485-86116507 ATACAGTTTAATCTGCAGCATGG + Intronic
910836719 1:91520741-91520763 ATACAGTGTAATAAGGACTAGGG + Intronic
913438751 1:118875065-118875087 ATAAAGAAGAATCAGCAGTAGGG - Intergenic
914442739 1:147721576-147721598 ACACAGATAAATTAGCAGCATGG + Intergenic
915164983 1:153943370-153943392 ATACTCATTAATAAACACTAAGG + Intronic
915812226 1:158925433-158925455 AAACAGATTATTAAGTATTAAGG + Intergenic
916335585 1:163667476-163667498 ATAAAGATTTCTAAGCAGCATGG - Intergenic
916576158 1:166068591-166068613 ATAGAGAATAAAAAGCAGCAGGG - Intronic
918763123 1:188440664-188440686 GTACAAATGAATAAGCAGAAAGG - Intergenic
918777120 1:188647856-188647878 ATAGAAAGTACTAAGCAGTATGG + Intergenic
919278561 1:195454111-195454133 ATACAGCTGAATTAGCAGTTTGG - Intergenic
919488867 1:198179472-198179494 ATACAGATTCTTGAACAGTAAGG + Intronic
919967329 1:202541139-202541161 ATACAGAGTAAGAAGAAGGACGG + Intronic
920249168 1:204611159-204611181 ATGCAGATTAGGAAGCAGTGAGG + Intergenic
921699369 1:218250019-218250041 ATGAAGATGAATAAGCAGTGAGG + Intergenic
922022740 1:221720530-221720552 ATACTGATTTATAAACAGTGTGG + Intronic
922379061 1:225002631-225002653 ATAATGATTAGTAAGCATTAGGG - Intronic
923635041 1:235686948-235686970 AAACAGATTTACAAGCAGCACGG - Exonic
1064632882 10:17335206-17335228 ATACAGATTTTTAAGTAATACGG - Intronic
1065121192 10:22531846-22531868 ATACAGATTAATTCTCATTAGGG + Intergenic
1065933332 10:30498665-30498687 AGATAGATTGATAAGCAATAGGG + Intergenic
1067743096 10:48911677-48911699 ATACAGAAAAATAACTAGTAAGG + Intronic
1070871352 10:79756320-79756342 ATAAACATTAATAAGGAATATGG + Intergenic
1071638288 10:87278528-87278550 ATAAACATTAATAAGGAATATGG + Intergenic
1071656956 10:87459424-87459446 ATAAACATTAATAAGGAATATGG - Intergenic
1075492361 10:122882578-122882600 ATAAGGATTAAGAAGCAGAAAGG + Intergenic
1075502444 10:122987980-122988002 ATACAAATTCAAAAACAGTATGG - Intronic
1076672835 10:132132651-132132673 AGCCAGATTAATGAGCAGTGTGG + Intronic
1079439965 11:20502654-20502676 AACCAGATTTATAAGCACTATGG + Intronic
1079888690 11:26022578-26022600 ATAAATAATAATAAGCATTATGG - Intergenic
1080633444 11:34102803-34102825 ATCCAGTTACATAAGCAGTACGG + Intergenic
1084094997 11:66905452-66905474 AACCAGATTAATTAGCATTAGGG - Intronic
1085238910 11:75035781-75035803 ATATATATTAACAAGCAGTAAGG + Intergenic
1086168140 11:83803593-83803615 ATACAGATTTGAAAGCAATAAGG + Intronic
1086294285 11:85347633-85347655 ATACAGATTAATTAACATCATGG - Intronic
1087484484 11:98744492-98744514 ATACAGCGTAATAAAAAGTAGGG - Intergenic
1087961787 11:104360369-104360391 ATACAGATTAATAGCCACCAAGG + Intergenic
1088156692 11:106813967-106813989 ATACAAGCTAATAAGCAGTAAGG + Intronic
1088384496 11:109238471-109238493 CTACAAATTTATAGGCAGTATGG - Intergenic
1090008278 11:123022054-123022076 ATACAGTTAAAAAAGCAATAAGG + Intergenic
1091543994 12:1488283-1488305 ATACAGATTAAAAAGCAAAAAGG - Intronic
1092438810 12:8478336-8478358 ATACAGATTAATGACCATTTTGG - Intergenic
1093423965 12:19006894-19006916 TTACATATTAATAAGAACTAAGG - Intergenic
1093528478 12:20133351-20133373 AGGCATATTAAAAAGCAGTAAGG - Intergenic
1098696951 12:73571896-73571918 AAAAAGACTAATAAGAAGTAAGG + Intergenic
1099926010 12:89018580-89018602 ATTAAGATTAATAAGAAATACGG - Intergenic
1101030642 12:100655086-100655108 ACACACATTAAAAATCAGTAGGG + Intergenic
1102103951 12:110304150-110304172 ATAAACATTATTCAGCAGTAAGG - Intronic
1102517621 12:113460703-113460725 ATAAAGATGAATGTGCAGTAAGG + Intergenic
1104383992 12:128333015-128333037 ATACACACAAATAATCAGTAAGG - Intronic
1105600844 13:21885755-21885777 AAACAGATAAATATGCAATATGG + Intergenic
1106718879 13:32418936-32418958 TTACAGGTTCATAAGCAGAAGGG + Intronic
1107252467 13:38380429-38380451 ATACAGATTAATAGGCAAGAAGG - Intergenic
1107372169 13:39764903-39764925 ATGCAGATTAAAAATCAGAAAGG - Intronic
1108135006 13:47346585-47346607 ATACATGTTAAGTAGCAGTAAGG + Intergenic
1109157858 13:58933886-58933908 ACACAGATCAATAAGCATCATGG - Intergenic
1109965077 13:69681710-69681732 ATACAGCTTAATGAGTAGTTTGG + Intergenic
1110879135 13:80549007-80549029 AGAATGATTAATAAGAAGTATGG - Intergenic
1112705012 13:102058795-102058817 ACTCAGAAAAATAAGCAGTAGGG - Intronic
1112778341 13:102870033-102870055 ATACAGAGTAAAGAGCAGGAAGG + Intronic
1113722019 13:112565460-112565482 ACAAATATTAATAAACAGTAAGG + Intronic
1115109225 14:29801436-29801458 ATGAACATGAATAAGCAGTAGGG + Intronic
1115673591 14:35644631-35644653 ATCCAGATAAATAATCAATATGG + Intronic
1115970971 14:38944437-38944459 TTGCAGATTTATAAGGAGTATGG - Intergenic
1116345265 14:43785098-43785120 ATAGAGATGAATAAGTACTATGG + Intergenic
1116578168 14:46603066-46603088 ATACAGTAGAATAAACAGTATGG + Intergenic
1117316967 14:54580601-54580623 ATACACATTAACACCCAGTAAGG - Intronic
1118567638 14:67159776-67159798 AAACAGATAAAGAAGCAGTTTGG - Intronic
1120465686 14:84854323-84854345 ATACAGATTATTAAAGAGGATGG + Intergenic
1120730972 14:88001443-88001465 AAACAGAGTAATAAAAAGTAAGG - Intergenic
1120851047 14:89170860-89170882 ATAGAATGTAATAAGCAGTAGGG + Intronic
1124786801 15:32689250-32689272 ATACATAATAATATGCATTATGG - Intronic
1128394596 15:67211260-67211282 GTACAGAATGAAAAGCAGTAGGG - Intronic
1130832808 15:87618787-87618809 GAACAGATAAATAACCAGTATGG + Intergenic
1131653300 15:94426354-94426376 AAATAGAATAATAAGAAGTATGG - Intronic
1133514947 16:6499606-6499628 ATTCAGCTTAAAAATCAGTAGGG + Intronic
1134405251 16:13952412-13952434 ATACAGAATGAAAAGCAGAAAGG - Intergenic
1134869813 16:17641840-17641862 AGAGAGATTAATAGGCAGTAAGG - Intergenic
1135702387 16:24643565-24643587 GAACAGAAGAATAAGCAGTACGG - Intergenic
1137450303 16:48567618-48567640 ATATAGATAAAAATGCAGTAGGG - Intronic
1138968371 16:62113947-62113969 ACACATATTAATAAATAGTAGGG + Intergenic
1140618940 16:76703921-76703943 ATATAAATTTATAACCAGTATGG - Intergenic
1144523876 17:15973348-15973370 AAACATAATAATAAACAGTATGG - Intronic
1147027132 17:37596587-37596609 ATGCATATTAAAAAACAGTATGG + Intronic
1149928404 17:60725110-60725132 ATAGAGATAAATAAGAAATAAGG - Intronic
1153446436 18:5178187-5178209 ATGCATATCAATAAGCAGGAGGG - Intronic
1155862199 18:30916529-30916551 ATACAGTTTAATAAGTAATCCGG - Intergenic
1157187962 18:45556671-45556693 ATACAGAATTTTAAGCAGCAGGG - Intronic
1159019355 18:63130523-63130545 AAACAGATTCATAAGCATTTGGG - Intronic
1162844807 19:13384114-13384136 ATACGACTTAATAAACAGTACGG - Intronic
1164692357 19:30220714-30220736 AGACAGATTTAAAAGCAGCAGGG - Intergenic
1165386038 19:35511182-35511204 ATACAGAGTCAGAAGCAGTGGGG + Intronic
925710159 2:6731396-6731418 AAACAGATAAATAAACAGGAGGG + Intergenic
926504725 2:13699497-13699519 CTACAGATGTATAGGCAGTATGG + Intergenic
927351592 2:22123480-22123502 AGACAGAAGAATAGGCAGTATGG - Intergenic
928841865 2:35617206-35617228 AAACAGATCAATAACAAGTAAGG - Intergenic
929006825 2:37403099-37403121 ATACACATTTAAAATCAGTAGGG - Intergenic
929517679 2:42619204-42619226 ATACAGATAAAGGAGCAGAATGG + Intronic
933079986 2:77973821-77973843 AGACAGATTAATTAGCAAAAAGG - Intergenic
935393173 2:102575893-102575915 AAACAGATGAATAATGAGTAAGG - Intergenic
935686023 2:105683451-105683473 ATACAGCTTTATAGCCAGTATGG + Intergenic
935812558 2:106813398-106813420 ATTCAGCATAATAAGCAGAATGG + Intronic
936052443 2:109235091-109235113 CCACAGAGCAATAAGCAGTACGG + Intronic
936168041 2:110140993-110141015 TCACAGATTATTAAGAAGTAGGG - Intronic
936715342 2:115180798-115180820 ATTGAGATAAATAAGCAGAAAGG - Intronic
936977224 2:118232268-118232290 AGACTGATGAATAAGCACTATGG - Intergenic
937892978 2:126954066-126954088 ATACAGAAAAACAAGCAGTAGGG - Intergenic
938697346 2:133846384-133846406 TTACATATTACTAAGAAGTATGG + Intergenic
939415541 2:141891774-141891796 CTTCATATTAATAAGCATTAGGG + Intronic
939424036 2:142010880-142010902 ATACACATTAATCACCAGGAAGG + Intronic
939675606 2:145068550-145068572 ATAAAAATTTATAAGCAGTGCGG - Intergenic
940501167 2:154495247-154495269 ATACAGATTAATAAGAGAAATGG + Intergenic
942982987 2:182104931-182104953 GAACAGATTAATAACAAGTAAGG - Intronic
943887305 2:193236228-193236250 ATACAGATTAATAACTAAAATGG + Intergenic
943981977 2:194564912-194564934 ATACAGACTAAAAAACATTAAGG - Intergenic
944397283 2:199282536-199282558 TTACAGATTAACAAGCACTGTGG - Intronic
944617760 2:201480218-201480240 ATACAGAAGAAAAAGCAGCAAGG - Exonic
944693929 2:202183984-202184006 AAAAAGATAAATAAGCAATATGG - Intronic
947125837 2:226867667-226867689 ATAAAGATTAAAAAGCTATAAGG + Intronic
1170086688 20:12541347-12541369 AAACAGATTAATAAGAAGTAAGG - Intergenic
1171242607 20:23584223-23584245 ATGCAGATTCAGAAGCAATAAGG + Intergenic
1173906008 20:46629739-46629761 AGAGAGATTAAGAAGCAGAAGGG - Intronic
1177396588 21:20544024-20544046 ACACAGTTTAATAAAAAGTAGGG - Intergenic
1183773226 22:39944872-39944894 ATTCACCTTAATAAGCAGGATGG - Intronic
1185246891 22:49777497-49777519 AAGCAGATTAATATGCAGCATGG + Intronic
954723770 3:52589633-52589655 AAACACATTAAGAAGCATTAAGG - Intronic
955358662 3:58253281-58253303 ATTCAGATTACTGAGCAGCAGGG - Intronic
955543669 3:60004555-60004577 ATACAGATTAATATGTGGTAAGG + Intronic
957229973 3:77500337-77500359 CCACATATTAATAAGCATTAGGG + Intronic
957621625 3:82600545-82600567 ATCCTGATTAACAAACAGTAAGG + Intergenic
958189605 3:90168287-90168309 ATACAGATTAAAAAACATTATGG + Intergenic
959462051 3:106639201-106639223 ATACAGTTTTATAAGAATTATGG - Intergenic
959604104 3:108223111-108223133 AAACAGATTAAGCAGCAGGATGG - Intergenic
962649697 3:137476139-137476161 AGACAGATGTATAAGCAGTCAGG + Intergenic
965764252 3:172113478-172113500 ATATAAATTATTAAGCAGCAAGG - Intronic
966157043 3:176927776-176927798 ATACAGGTCAGTAAGCAGAAAGG - Intergenic
967371047 3:188746385-188746407 CTACAGGTTAATTAGTAGTATGG + Intronic
969980820 4:11152130-11152152 ATACAGATTAAAAAGCAAGTTGG - Intergenic
970978839 4:22073756-22073778 ATAAAGATTAATAACAAGGATGG - Intergenic
971008036 4:22397525-22397547 ATAAAGTTTCATAGGCAGTATGG + Intronic
971533980 4:27724836-27724858 ATACACAATATTAATCAGTATGG + Intergenic
974103746 4:57444589-57444611 AGACAGATAAGTAAGGAGTAAGG + Intergenic
974511118 4:62842089-62842111 TTAAAGTTTAATAAGTAGTAGGG - Intergenic
974583548 4:63838208-63838230 ATACTTATTCATAAGCAGAAAGG + Intergenic
974772381 4:66433469-66433491 TTACAGACTAATAGGCAGAAGGG - Intergenic
974894608 4:67924278-67924300 ATATAGATTAATTAGGAGAATGG + Intronic
975235117 4:71985559-71985581 ACACAGAACAATAGGCAGTATGG - Intergenic
978460506 4:108946667-108946689 ATACAGAGTGATAAGTATTATGG + Intronic
978624302 4:110667016-110667038 CTAAAGATTAATGACCAGTATGG + Intergenic
979508740 4:121527576-121527598 ATACAGAGTAATTGGCAATATGG - Intergenic
980379328 4:131991185-131991207 ATAAAGCCTAATAATCAGTATGG - Intergenic
980523089 4:133957159-133957181 TTACAGATTCATAGGCAGAAGGG - Intergenic
980939811 4:139263106-139263128 ATACCAATTTATAGGCAGTATGG + Intergenic
981463841 4:145042861-145042883 GTACAGAGAAATAAGCAGTTAGG - Intronic
981994099 4:150957671-150957693 TTACAGATTCATAGGCAGAAGGG - Intronic
983847489 4:172538012-172538034 GTACAGATTATTAAGCACCAAGG + Intronic
985991345 5:3564569-3564591 ATAAAGATTACTAGGCAGTTGGG + Intergenic
986996377 5:13612000-13612022 ATAGAGATTGATAATCTGTAGGG + Intergenic
987107009 5:14649430-14649452 ATACAGATCAATAAATATTATGG + Intergenic
987329643 5:16845199-16845221 CTACAGATAATTCAGCAGTAAGG - Intronic
987691554 5:21273295-21273317 TTACAGATTAATCAGCATTGTGG + Intergenic
987728663 5:21737954-21737976 ATACAAATTAAAAAGAAGAATGG + Intergenic
987746256 5:21976292-21976314 ATACACATGAATAAGCGATAAGG + Intronic
987884956 5:23800872-23800894 ATACAGGCTCATAGGCAGTAGGG + Intergenic
987998868 5:25323426-25323448 ATACAGACAAAAAAGTAGTATGG + Intergenic
988338042 5:29931616-29931638 TTACACATTAGTAAGCTGTAGGG + Intergenic
989310064 5:40005334-40005356 ATGCAGACTAATAAGAAGCAAGG - Intergenic
989435586 5:41409527-41409549 ATACAGACTAACAGGCAGCAGGG - Intronic
990213634 5:53507525-53507547 TTACAGGTTCATAAGCAGAAGGG - Intergenic
991393002 5:66169122-66169144 TTACAATTTAATAAGCAGTTAGG + Intronic
991748825 5:69776842-69776864 TTACAGATTAATCAGCATTGTGG - Intergenic
991766463 5:69986405-69986427 ATACACATGAATAAGCGATAAGG + Intergenic
991780851 5:70131700-70131722 ATACACATGAATAAGCGATAAGG - Intergenic
991800403 5:70356654-70356676 TTACAGATTAATCAGCATTGTGG - Intergenic
991828197 5:70653387-70653409 TTACAGATTAATCAGCATTGTGG + Intergenic
991845696 5:70861490-70861512 ATACACATGAATAAGCGATAAGG + Intergenic
991873297 5:71132013-71132035 ATACACATGAATAAGCGATAAGG - Intergenic
991892761 5:71356094-71356116 TTACAGATTAATCAGCATTGTGG - Intergenic
994578359 5:101609567-101609589 ATACAGTATAGTAAGCAGGATGG - Intergenic
996690971 5:126339611-126339633 AAGCAGATTAATAATCAGCAAGG - Intergenic
996799992 5:127392503-127392525 ATACTGAATAATAAGTAATAAGG - Intronic
1000804623 5:165774553-165774575 AAACATTTTAAAAAGCAGTATGG - Intergenic
1001233210 5:170007825-170007847 CTGCAGGTTAATAAGCAGTCAGG - Intronic
1003981646 6:11395692-11395714 ATTCTGATTATTAAGCACTATGG + Intergenic
1005384945 6:25276943-25276965 TTACAGATTCAAATGCAGTAGGG + Intergenic
1005655551 6:27932884-27932906 GTACATAGTAATAAGCATTAAGG - Intergenic
1010380712 6:75221301-75221323 ACACAGATTACAAAGCACTATGG + Intergenic
1010542213 6:77105663-77105685 ATATAGATTAATATGTAGGAAGG - Intergenic
1011458181 6:87575125-87575147 ATACAGATTATGAAGCAGAATGG + Intronic
1011849273 6:91605162-91605184 TTACAGATTAAAATTCAGTATGG + Intergenic
1011929789 6:92697332-92697354 ATACAAATTAGTAAGCAATTAGG + Intergenic
1012791541 6:103704161-103704183 ATTCAGTTTAATAAGAAGTCAGG - Intergenic
1013847032 6:114465641-114465663 AAACAGAAAAATAATCAGTAGGG - Intergenic
1014731128 6:125032352-125032374 AGACAGATTATTAAGAATTATGG - Intronic
1016121665 6:140350183-140350205 ATACAGATTGATAAGCACTTTGG + Intergenic
1016126244 6:140407969-140407991 ATACACATTTAGAAACAGTAAGG - Intergenic
1017809609 6:157975422-157975444 ATAGAGACTAATAAGCACTAAGG + Intergenic
1019083605 6:169453770-169453792 ATACAGATTAGTAAGAATTTGGG + Intergenic
1020979660 7:15052324-15052346 TTACAGGTTCATAAGCAGAAGGG - Intergenic
1022770701 7:33469520-33469542 ATAGAAATTGATAAGGAGTAGGG + Intronic
1022895252 7:34744032-34744054 ATACATAATAATAATCAGCAAGG - Intronic
1023373599 7:39535018-39535040 ATACTGATAAAGAAGCAGAAGGG + Intergenic
1024181117 7:46896211-46896233 AGCCAGGTTAATAAGCAGTCTGG - Intergenic
1026196880 7:68180987-68181009 ATACAGATTTATAAGTTATAGGG + Intergenic
1026769432 7:73185473-73185495 ATACATATGAATAAACATTAAGG - Intergenic
1027010301 7:74738857-74738879 ATACATATGAATAAACATTAAGG - Intronic
1027077741 7:75207180-75207202 ATACATATGAATAAACATTAAGG + Intergenic
1029530928 7:101124881-101124903 AGGCAGATTAAAAAGCAGGAGGG + Intergenic
1029881114 7:103810896-103810918 GTACAGCTTAATATGCAGCAAGG - Intronic
1029926040 7:104318403-104318425 ATTCTGATTAATCAGCAATATGG - Intergenic
1030230315 7:107201821-107201843 ATACAGATTAATAAGCAGTAAGG - Exonic
1031244752 7:119296654-119296676 ATTCAGATTAAGAAATAGTAAGG - Intergenic
1031713293 7:125075835-125075857 TTACAGATTCATAGGCAGAAGGG + Intergenic
1032623187 7:133559130-133559152 ACACAAATCAATAAGAAGTATGG - Intronic
1033905100 7:146192840-146192862 TTACAGATTCATAGGCAGAAGGG - Intronic
1034362437 7:150512490-150512512 ATACAGAAGAAAAAGCAGCAAGG + Intergenic
1037133279 8:15432287-15432309 ACACAGATGAATAAGGAGTAAGG - Intronic
1038423294 8:27447887-27447909 ATACAATTCAATAAACAGTAGGG + Intronic
1039269354 8:35863820-35863842 ATACAAAGGAATAAGCAGGATGG - Intergenic
1040075436 8:43224611-43224633 CGAGAGATTAATAAGCAGAATGG + Intergenic
1040332409 8:46393690-46393712 AAACAGATGAATAAAAAGTAAGG + Intergenic
1041527783 8:58827055-58827077 AAACAGATTTTTAAGAAGTATGG + Intronic
1041927949 8:63255991-63256013 AAACAGATTCATAAGAGGTAAGG - Intergenic
1043852613 8:85231931-85231953 ATACACTTTAATAAGTAGTTTGG + Intronic
1044889279 8:96815436-96815458 ATACAACTTAACAAGCAGAATGG + Intronic
1045711393 8:104988743-104988765 ATGCAGAATATTAAGCAGTATGG + Intronic
1046147190 8:110176324-110176346 ATACAGAATAAGAAACAGAAAGG + Intergenic
1048570382 8:135649733-135649755 ATACAGAATAATAAGAATTATGG + Intronic
1052872151 9:33517797-33517819 CTAGAGATTAATAAGCAGAATGG + Intergenic
1055176902 9:73330285-73330307 GAACAGATTAATAAAGAGTAAGG - Intergenic
1059302643 9:113327323-113327345 GAAAAGATTAATAAGCAGAAAGG - Intronic
1060311349 9:122465370-122465392 CAAGAGATTAATAAGCAGAATGG + Intergenic
1186291362 X:8103386-8103408 ATACAGATTAATAAGAGAAAAGG - Intergenic
1186663890 X:11699064-11699086 ATTCAAATTAACAAGCATTAGGG + Intergenic
1186997565 X:15140012-15140034 ATAAAGATGAATAAGCAGGAGGG + Intergenic
1188228380 X:27630337-27630359 TTACAGAATAATAATGAGTAAGG + Intronic
1188779235 X:34259872-34259894 ATACAGAGTAATATGCACTCTGG + Intergenic
1189850826 X:45174498-45174520 ATACAGAAGAGAAAGCAGTAGGG + Intronic
1190007440 X:46754350-46754372 ATACAGTTTTATAAGCAACAGGG + Intronic
1192327661 X:70146989-70147011 TTACAGATTAAAAAGCACTGGGG - Intronic
1192635706 X:72814598-72814620 GTACAGAACAATAAGGAGTAAGG - Intronic
1192646008 X:72906205-72906227 GTACAGAACAATAAGGAGTAAGG + Intronic
1193139435 X:78010957-78010979 ATACATATTAACTAGCATTAAGG + Intronic
1194353300 X:92849657-92849679 ATACAGCTGCAGAAGCAGTAGGG - Intergenic
1194866594 X:99076614-99076636 ATACAGTTCAACAAGCATTACGG + Intergenic
1195243949 X:102979494-102979516 CCTCAGATTAATAAGCAGTGAGG - Intergenic
1195521110 X:105830496-105830518 ATAAAAAAGAATAAGCAGTATGG - Intronic
1196191445 X:112799307-112799329 ATACAGATCAGTAGGCAGAAAGG + Intronic
1197096187 X:122598590-122598612 AAACAGATTAATAATCATCAGGG + Intergenic
1197096194 X:122598702-122598724 AAACAGATTAATAATCATTAGGG + Intergenic
1197656627 X:129123613-129123635 ATACAGAAGAAGAACCAGTAGGG + Intergenic
1198325630 X:135569417-135569439 ATACATACTAATAGGTAGTATGG - Exonic
1200661658 Y:5966730-5966752 ATACAGCTGCAGAAGCAGTAGGG - Intergenic
1200921400 Y:8616624-8616646 ATACAGTGTGAGAAGCAGTAAGG + Intergenic
1201547762 Y:15184640-15184662 ATAAAGATTAATAAGAGGAAAGG - Intergenic
1202231807 Y:22666344-22666366 ATACAGAAAAATAAGAAGGAAGG - Intergenic
1202302929 Y:23436903-23436925 ATACAGAGTAAGAAGAAGGACGG + Intergenic
1202311351 Y:23529821-23529843 ATACAGAAAAATAAGAAGGAAGG + Intergenic
1202559451 Y:26140773-26140795 ATACAGAAAAATAAGAAGGAAGG - Intergenic
1202567882 Y:26233691-26233713 ATACAGAGTAAGAAGAAGGACGG - Intergenic