ID: 1030230336

View in Genome Browser
Species Human (GRCh38)
Location 7:107201964-107201986
Sequence CAGAACATGGGGCAGGTGGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 456
Summary {0: 1, 1: 0, 2: 4, 3: 43, 4: 408}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030230325_1030230336 20 Left 1030230325 7:107201921-107201943 CCAAACATAGGCGCTCCTAGTCT 0: 1
1: 0
2: 0
3: 2
4: 28
Right 1030230336 7:107201964-107201986 CAGAACATGGGGCAGGTGGCTGG 0: 1
1: 0
2: 4
3: 43
4: 408
1030230327_1030230336 5 Left 1030230327 7:107201936-107201958 CCTAGTCTGGTCAGTGCCAAGAG 0: 1
1: 0
2: 1
3: 12
4: 125
Right 1030230336 7:107201964-107201986 CAGAACATGGGGCAGGTGGCTGG 0: 1
1: 0
2: 4
3: 43
4: 408

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030230336 Original CRISPR CAGAACATGGGGCAGGTGGC TGG Exonic
900162129 1:1228786-1228808 CAGACCATGGGGCGGGCTGCAGG + Exonic
900285799 1:1899764-1899786 CAGGAAATGGGGCTGGGGGCTGG - Intergenic
900412777 1:2520471-2520493 CAGCACATGGGGCGGGGGGCGGG - Intronic
900542797 1:3212502-3212524 CAGAACATGGGGACGGAGGCAGG - Intronic
900616796 1:3569149-3569171 CTGAACAGGCGGCTGGTGGCGGG - Intronic
900646847 1:3712932-3712954 CAGAGGGTGGGGCAGGGGGCAGG - Intronic
900824666 1:4916814-4916836 CTGGAAATGGGGCAGCTGGCGGG - Intergenic
900977201 1:6025312-6025334 CTCAACACGGTGCAGGTGGCTGG + Intronic
901564865 1:10105686-10105708 CAGAACATGGGGCTTGTTCCTGG - Exonic
901854758 1:12037616-12037638 CAGAAAATGTGTCAGGTGGTGGG + Intergenic
902330430 1:15728600-15728622 AAGAAAATGGGGCAGGGGGAGGG + Intronic
902447642 1:16477078-16477100 CAGGACAGAGGGCAGGTGGGTGG + Intergenic
903281172 1:22250834-22250856 CAGAAAAGGCGGCAGGTGCCAGG - Intergenic
903420372 1:23214734-23214756 CAGGGCATGGGGCAGGTGGAGGG - Intergenic
904598464 1:31661201-31661223 CCAAAGCTGGGGCAGGTGGCAGG - Intronic
904849644 1:33447669-33447691 CAGAACCTGGGGCCGGTGACAGG + Intergenic
905277334 1:36826969-36826991 CAGAACATGGGGCTGAAGGAGGG - Intronic
905399610 1:37692018-37692040 CCGAACTTCGGGCAAGTGGCGGG - Intronic
906288354 1:44603030-44603052 CAGATCCTTGGGCAGGTGGCAGG - Intronic
906472801 1:46145190-46145212 CAAAACATGGGGGAGATGGGAGG + Intronic
906686161 1:47764745-47764767 CAGAACAGGGAACAGGAGGCAGG + Exonic
907313347 1:53552348-53552370 CACAGCATGGCCCAGGTGGCAGG + Intronic
907316454 1:53575683-53575705 CAGGACATGGAGCAGGTGCTTGG + Intronic
907414273 1:54303374-54303396 CAGCCCAGGGGGCAGGGGGCAGG + Intronic
907555055 1:55336159-55336181 CAGAAGAAGGGGCAGGAGGGAGG + Intergenic
907737100 1:57124946-57124968 AAGAACATGAGGCATGAGGCCGG - Intronic
909122039 1:71615641-71615663 GAGAAGGTGGGGCAGGGGGCTGG + Intronic
912474643 1:109927860-109927882 TAGAAGATGGGGCAGCAGGCTGG + Intronic
912502189 1:110129981-110130003 GAGCATATGGGGAAGGTGGCGGG + Intergenic
912806214 1:112758933-112758955 CAGAAATTGGGGCTGGTGGGTGG + Intergenic
913203507 1:116515332-116515354 CAGACCACGGGGGAGGAGGCCGG - Intronic
913260005 1:116989268-116989290 GTGGACATGGGGCAGGTGGGTGG - Exonic
916142485 1:161711573-161711595 CAGACTATGGAGCAGGTTGCTGG + Intronic
916374681 1:164139452-164139474 AAGGAAAAGGGGCAGGTGGCTGG + Intergenic
918471914 1:184884075-184884097 CAGAACATGGGGCAGTTATCTGG - Intronic
919790720 1:201289093-201289115 CAGCAGAGGGGGCAGGAGGCTGG + Intronic
920128328 1:203711579-203711601 TGGAACATGGGCCAGGTGGGTGG + Intronic
920430764 1:205917421-205917443 CAGGAAAAGGGACAGGTGGCCGG + Intronic
921165345 1:212503059-212503081 GTGGACATGGGGCAGGAGGCTGG - Intergenic
922075436 1:222238998-222239020 CAGGACATGGGGCAGGTAGCTGG - Intergenic
922478689 1:225924066-225924088 CAGAGCATAGGCCAGCTGGCCGG + Exonic
923118578 1:230968565-230968587 TAGAGCAGGGGGCAGGTGGGAGG + Intronic
923314472 1:232766431-232766453 CTCGACATGGGGCAGGAGGCAGG + Intergenic
1062895746 10:1101863-1101885 CAGGACAAGGGGCAGCTGGATGG - Intronic
1063534856 10:6873407-6873429 CAGACCACGGGTCAGGTGGGAGG - Intergenic
1063655430 10:7983315-7983337 CAGAATAAGGGGCAAGAGGCAGG + Intronic
1064143257 10:12807644-12807666 CAGGACAAGGAGCAGGTAGCCGG - Intronic
1064164271 10:12973285-12973307 CAGGACCTGGGACACGTGGCTGG - Intronic
1064742910 10:18451376-18451398 CAGAGCAGGGGCCAGGTGGGAGG - Intronic
1065060877 10:21899442-21899464 CAGGACCTGGGGCAAGGGGCAGG + Intronic
1066226602 10:33389596-33389618 CAGGAGATGGGACAGGTGCCAGG + Intergenic
1066497394 10:35955400-35955422 CAGAACATGGGGTGGGGAGCAGG + Intergenic
1069956430 10:72054646-72054668 CAGAACCTGGGGCTGGTGACGGG + Intergenic
1070314480 10:75296747-75296769 GAAAACATGGGGCAGGGGGAGGG + Intergenic
1070631144 10:78085678-78085700 TAGAACAGGGGGTATGTGGCAGG + Intergenic
1071524052 10:86347959-86347981 GGGACCATGGGGAAGGTGGCCGG - Intronic
1072100534 10:92225267-92225289 CAGAAAATGGGGTAGGAGGCTGG - Intronic
1073542255 10:104323823-104323845 CAGATCCAGGGGCAGGTGCCTGG - Intronic
1074163870 10:110857969-110857991 AGGCACATGGGGCAGGAGGCCGG - Intergenic
1075397257 10:122136416-122136438 ACCAACATGGGGCAGGGGGCAGG + Intronic
1076154367 10:128192302-128192324 AAAACCATGGGGCAGGTGGGTGG - Intergenic
1076383845 10:130043595-130043617 CAGACCAAGGGGCAGGTTGGGGG + Intergenic
1077221897 11:1421673-1421695 CAGGAGCTGGGGCAGGGGGCAGG - Intronic
1077339690 11:2020790-2020812 CAGGACAGGCGGCAGGTGGGAGG - Intergenic
1077592012 11:3499560-3499582 CAGAAGATGGGCCAGGGGCCAGG + Intergenic
1079243496 11:18737156-18737178 CAGAACTTGGCGAGGGTGGCAGG + Intronic
1079384642 11:19968012-19968034 CAGAACCTGGGGCAGCAGGGAGG - Intronic
1080496899 11:32829748-32829770 CAGAACTGGCGGCAGGCGGCTGG + Intergenic
1080603933 11:33848303-33848325 CAGAGCAGGAGGAAGGTGGCGGG - Intergenic
1081572168 11:44298491-44298513 CAGCACCCTGGGCAGGTGGCAGG + Intronic
1083061659 11:59879223-59879245 CAGGACAGGAGGCAGGTGGCAGG - Intergenic
1083184517 11:61009407-61009429 GAGCAAATGGGGCAGGTGACAGG + Intronic
1083679027 11:64342850-64342872 CAGAGGATGGGGCAGGTGTAGGG + Intronic
1083701687 11:64483503-64483525 CAGAACATTTGCAAGGTGGCAGG + Intergenic
1084247852 11:67872292-67872314 CAGAAGATGGGCCAGGGGCCAGG + Intergenic
1084454606 11:69261219-69261241 CAGGAGATGGGGCAGGAGACTGG - Intergenic
1084767229 11:71320496-71320518 CAAAGCATGAGGCAGGTGGGAGG - Intergenic
1084857629 11:71999120-71999142 CCGACCTTGGGGCTGGTGGCTGG + Exonic
1085405468 11:76259130-76259152 GACAACATGGGGCAGGGGGGCGG + Intergenic
1085708999 11:78812298-78812320 CAGAGCACGGGGCAGGAGGCTGG + Exonic
1088129601 11:106471779-106471801 TAGAACACTGGGCAGGTGGAAGG - Intergenic
1089453766 11:118613882-118613904 CAGACCATGGTGCAGGTGAGTGG + Exonic
1089486933 11:118853780-118853802 TAAAACATGTTGCAGGTGGCTGG - Intergenic
1089663523 11:120001566-120001588 GAGCACACAGGGCAGGTGGCGGG - Intergenic
1089689860 11:120180584-120180606 CAGAGCTTGGGGCAGGAGCCTGG + Intronic
1090075106 11:123575695-123575717 CAGGCCGTGGGGCTGGTGGCAGG - Intronic
1090278058 11:125433287-125433309 CATAACATTAGGCAGGTGGAGGG - Exonic
1090728026 11:129545024-129545046 AAGAACAAGGGGGAGATGGCAGG + Intergenic
1090932167 11:131307748-131307770 CAGAACTTTCGGCAGCTGGCAGG + Intergenic
1202822675 11_KI270721v1_random:75979-76001 CAGGACAGGCGGCAGGTGGGAGG - Intergenic
1091769653 12:3142635-3142657 AAGAGCATGGCGCAGGGGGCAGG - Intronic
1091931503 12:4399326-4399348 GAGAGCATGGGGCAGGGGGAGGG + Intergenic
1092233836 12:6793209-6793231 CAGAACAGGGAGCTGGAGGCAGG + Intronic
1092418127 12:8307683-8307705 CAGAAGATGGGCCAGGGGCCAGG + Intergenic
1095849949 12:46791682-46791704 CAGACAATGTGGCAGGTGGTGGG + Intronic
1096072308 12:48782239-48782261 CAGAATGTGGGGCTGGAGGCAGG - Intronic
1096514760 12:52149717-52149739 CAGGACAGGGGGCAGGAGGAGGG - Intergenic
1097265868 12:57744638-57744660 CAGAACAGGGGGAAGGGGGTGGG + Intronic
1097854816 12:64451760-64451782 CAGAACGTGGGACACGTGGGGGG - Intergenic
1098481372 12:70965255-70965277 CAAAACATGGGGCAGGGGATTGG + Intergenic
1099321539 12:81156868-81156890 TAGAAGAGGAGGCAGGTGGCTGG + Intronic
1099455464 12:82857424-82857446 CAGAACCTGGGGCTGGTTCCTGG + Exonic
1100616072 12:96232615-96232637 CAGGAGATGGGGGAGGGGGCGGG + Intronic
1102255136 12:111410683-111410705 CAGGCCACGGGGCAGCTGGCTGG - Intronic
1103418781 12:120763160-120763182 CAGAACAGGGAGGAGATGGCTGG + Exonic
1103613553 12:122138401-122138423 CTGCAGAAGGGGCAGGTGGCTGG - Intronic
1104041873 12:125136040-125136062 CAAAAAAGGAGGCAGGTGGCCGG - Intronic
1104948311 12:132427330-132427352 CAGGGCCTGGGGCGGGTGGCCGG + Intergenic
1105069429 12:133225760-133225782 CAGAAGAGGGGGAGGGTGGCAGG + Intronic
1105215958 13:18285533-18285555 ATGAACACGGGGCAGGGGGCAGG - Intergenic
1105308991 13:19189706-19189728 CAGGACATGGGCCAGGAAGCTGG + Intergenic
1105528611 13:21198445-21198467 CAGGACATGGGCCAGGAAGCTGG - Intergenic
1105580057 13:21687231-21687253 CATATTGTGGGGCAGGTGGCAGG + Intronic
1106325355 13:28684185-28684207 CAGAAATTGGAGCAGGTGCCGGG - Intergenic
1106819340 13:33445761-33445783 CAGAAGAGGGGCCAGGTGCCAGG + Intergenic
1107918844 13:45182391-45182413 AAGAACATTGGGAAAGTGGCCGG - Intronic
1111672582 13:91348425-91348447 CGGCACATGGGGCAGGCCGCGGG + Intergenic
1112798800 13:103087932-103087954 CAGAAGATGAAGCAAGTGGCTGG + Intergenic
1112979799 13:105369137-105369159 CAAAACATAGGGCAGGCTGCGGG + Intergenic
1113762878 13:112862372-112862394 CAGAGCCTGGGGGAGGTGCCGGG + Intronic
1116317596 14:43417644-43417666 CAGAATACAGGTCAGGTGGCTGG + Intergenic
1116868721 14:50052004-50052026 CAGAGAGTGGGGCAGGTGGAAGG + Intergenic
1117748248 14:58893204-58893226 CAGAAAAAGGGGCAGGAGACAGG + Intergenic
1118835123 14:69472437-69472459 CAGAACATGGGGGTGGGGACAGG - Intergenic
1119646160 14:76350084-76350106 CAGAAGTTGGGGCAGGTTGGTGG - Intronic
1121445093 14:93973751-93973773 CAGAATATGGGTCAGGGGCCTGG - Intronic
1121684811 14:95827884-95827906 CAGAAAATGGAGCTGGTGACTGG + Intergenic
1122521227 14:102345262-102345284 CTGAACATGGACCAGGTGCCAGG - Intronic
1122819154 14:104332626-104332648 CAGAGCATGGGTTGGGTGGCAGG - Intergenic
1122969821 14:105147979-105148001 CAGACCCGGGGGCAGGGGGCAGG + Intronic
1123020273 14:105394690-105394712 CACAGCATGGGGCAGGAGGTGGG - Exonic
1123666565 15:22613146-22613168 CAGGGGATGGGGCAGGTGGTTGG + Intergenic
1124112691 15:26806821-26806843 CAGAGCATGGGGCAGGAGGTGGG + Intronic
1124320408 15:28707719-28707741 CAGGGGATGGGGCAGGTGGTTGG + Intronic
1124482106 15:30087691-30087713 CAGGGGATGGGGCAGGTGGTTGG - Intronic
1124488564 15:30139791-30139813 CAGGGGATGGGGCAGGTGGTTGG - Intronic
1124521482 15:30409512-30409534 CAGGGGATGGGGCAGGTGGCTGG + Intronic
1124537179 15:30556707-30556729 CAGGGGATGGGGCAGGTGGCTGG - Intronic
1124543650 15:30608763-30608785 CAGGGGATGGGGCAGGTGGTTGG - Intronic
1124754964 15:32398531-32398553 CAGGGGATGGGGCAGGTGGTTGG + Intronic
1124761474 15:32450884-32450906 CAGGGGATGGGGCAGGTGGCTGG + Intronic
1124777158 15:32598184-32598206 CAGGGGATGGGGCAGGTGGCTGG - Intronic
1125110573 15:36027566-36027588 CAGAACATGGGGTGGGTAGGAGG + Intergenic
1125463313 15:39926701-39926723 CTGAAATGGGGGCAGGTGGCGGG + Intergenic
1126241453 15:46449325-46449347 CAGAAAGTGGGGCAGTTGTCAGG + Intergenic
1126603403 15:50451663-50451685 ACCAACATGGGGCAGGAGGCTGG - Intronic
1127675111 15:61230619-61230641 CAGAACGTGGGGTAGGCGGAGGG + Intergenic
1127890217 15:63243684-63243706 CAGAATTTGGGGAAGGGGGCAGG + Intronic
1128406574 15:67346592-67346614 CACAACAGGAGGCAAGTGGCAGG - Intronic
1129296321 15:74602245-74602267 GAGAACCTGGGGCAGGGGGCAGG - Intronic
1129869023 15:78929115-78929137 AGGAAGATGGGGCAGGTGGGGGG + Intronic
1131116804 15:89801044-89801066 CAGAACATGGGCCAGGAGCTAGG + Intronic
1131270187 15:90942519-90942541 CATAACCTGCAGCAGGTGGCAGG - Exonic
1132556684 16:575710-575732 CAGGACAGGGGGCAGGTGGGAGG - Intronic
1133283011 16:4677650-4677672 GAGAACACGGGGCTGCTGGCTGG - Intronic
1133357489 16:5147288-5147310 CAGAAGATGGGCCAGGGGCCAGG + Intergenic
1134849504 16:17469442-17469464 GAGCACATGGGGCAGGAGGCCGG - Intronic
1134884255 16:17775859-17775881 ATGAACATGGGGCAGGTGCAGGG - Intergenic
1135506301 16:23039775-23039797 AAGTAGAAGGGGCAGGTGGCAGG + Intergenic
1135771932 16:25224419-25224441 CAGGAGCAGGGGCAGGTGGCAGG + Exonic
1135851659 16:25969291-25969313 CAAAACATGGGGCAGTTCCCTGG + Intronic
1136173005 16:28499521-28499543 TAGAGCCTGGGGCAGGGGGCTGG + Exonic
1136266393 16:29121869-29121891 CAGGACACAGGGCAGGTGACAGG + Intergenic
1136867259 16:33768200-33768222 GCGGGCATGGGGCAGGTGGCAGG - Intergenic
1137615757 16:49845932-49845954 CAGGACATGGGGCTGCTGGAGGG + Intronic
1138009186 16:53361988-53362010 CAGGGGATGGGGCAGGTGGTTGG + Intergenic
1138650163 16:58455719-58455741 CAGAGCCTGGGGCAAGGGGCAGG + Intergenic
1139513841 16:67442056-67442078 TAGAGCATGGGCCAAGTGGCAGG - Intronic
1140111405 16:72008599-72008621 CAGAACCTGGGGGTGGTGCCGGG + Intronic
1141273249 16:82559664-82559686 CAGAAGAGGGGCCTGGTGGCAGG - Intergenic
1141326857 16:83068576-83068598 CAGAAGAATGGTCAGGTGGCTGG - Intronic
1142055254 16:87989982-87990004 CAGGACACAGGGCAGGTGACAGG + Intronic
1142213395 16:88819195-88819217 AAGAGGCTGGGGCAGGTGGCCGG - Intronic
1142358890 16:89616977-89616999 CAGAGAATGGGGCGGGAGGCTGG + Intronic
1203104903 16_KI270728v1_random:1348003-1348025 GCGGGCATGGGGCAGGTGGCAGG + Intergenic
1203128611 16_KI270728v1_random:1614365-1614387 GCGGGCATGGGGCAGGTGGCAGG - Intergenic
1142809287 17:2387655-2387677 GGGAACATGGGGCAGGGAGCAGG + Intronic
1143266230 17:5640024-5640046 CAGGTCATGAAGCAGGTGGCAGG - Intergenic
1143335816 17:6170806-6170828 CATCACATGGGGCAGCCGGCTGG - Intergenic
1143378219 17:6479662-6479684 CAGAATCTGGGGCAGGTGACAGG + Intronic
1143519713 17:7438344-7438366 CAGAGCACTGGGCCGGTGGCTGG - Intronic
1144390841 17:14792019-14792041 AGGAACATGGAGCATGTGGCAGG - Intergenic
1144725884 17:17502604-17502626 CATAAAATTGGCCAGGTGGCAGG + Intergenic
1144792420 17:17867977-17867999 CAAAGCCTGGGGCTGGTGGCTGG - Intronic
1144965485 17:19074873-19074895 GAGAAGAGAGGGCAGGTGGCAGG - Intergenic
1144982482 17:19177310-19177332 GAGAAGAGAGGGCAGGTGGCAGG + Intergenic
1144985741 17:19200929-19200951 GAGAAGAGAGGGCAGGTGGCAGG - Intergenic
1144998475 17:19287231-19287253 GGGAACAGGGGGCAGGTGGTGGG - Intronic
1145275549 17:21427176-21427198 GAGAACATGGGGCGGGTGACTGG + Intergenic
1145313398 17:21713070-21713092 GAGAACATGGGGCAGGTGACTGG + Intergenic
1145711849 17:26985026-26985048 GAGAACATGGGGCGGGTGGCTGG + Intergenic
1146273311 17:31498433-31498455 CAGAAGATGGGGCAGGGAGGAGG + Intronic
1146785848 17:35720724-35720746 AAAAATATGGGGCAGGGGGCGGG - Intronic
1147793511 17:43027353-43027375 CATAACATGGGCCAGGAGGAGGG + Intronic
1148206733 17:45784257-45784279 CGGACCGTGGGGGAGGTGGCGGG + Intergenic
1148222156 17:45870661-45870683 CTGAACAAGGGGCAAGAGGCCGG - Intergenic
1148586995 17:48788011-48788033 CAGAACATGGGGCTGCTGTCAGG + Intronic
1149962773 17:61130495-61130517 CATAAACTGGGGGAGGTGGCAGG - Intronic
1152235586 17:79136640-79136662 CAGAAGATGGGGAAGGTGCTGGG + Intronic
1152341832 17:79729913-79729935 GCGGGCATGGGGCAGGTGGCAGG - Intergenic
1152579358 17:81159306-81159328 CCCAACATGGGGCAGCTGGGAGG + Intronic
1152640721 17:81448180-81448202 CAGAGCAGGAGGCAGGCGGCAGG - Intronic
1153008822 18:519429-519451 AGGAACATGGGGCTGCTGGCAGG - Intergenic
1153295025 18:3536828-3536850 GAGAACATGGGGAAGGTGGGAGG + Intronic
1155174768 18:23292417-23292439 CAGAACCTGAGGGAGGAGGCTGG + Intronic
1156537258 18:37876160-37876182 CAGTGCATGGTGCTGGTGGCGGG - Intergenic
1156873304 18:41974552-41974574 AAGAAAATGGGGCAGGGGGTGGG - Intronic
1158664587 18:59420954-59420976 AAGAACATGGGGATGCTGGCTGG + Intergenic
1160010824 18:75106026-75106048 CAGCCCCTGTGGCAGGTGGCAGG - Intergenic
1160081157 18:75728535-75728557 CTGAACATGAGGCAGGGGACAGG - Intergenic
1161327318 19:3670080-3670102 AGGAACCTGGGGCAGGCGGCAGG + Intronic
1161390446 19:4017636-4017658 CAGCACATGGGCCAGCTGGAGGG + Intronic
1161494097 19:4578236-4578258 AAGGACATGGGGCCGGTGGCTGG + Intergenic
1161699796 19:5788333-5788355 TAGGACCTGGGTCAGGTGGCTGG - Intronic
1161709835 19:5841692-5841714 CCCAACATCGGCCAGGTGGCTGG + Intergenic
1162048297 19:8016173-8016195 TGGAACCGGGGGCAGGTGGCTGG + Intronic
1162510359 19:11114242-11114264 GAGTACACCGGGCAGGTGGCAGG - Intronic
1163034731 19:14564096-14564118 CAGTAAGTGGGGCAGGTGGGAGG + Exonic
1163218441 19:15897507-15897529 CAGGACATGGGCCAGGAGCCAGG + Exonic
1163472506 19:17505692-17505714 CAGGACAGGAGGCAGCTGGCTGG - Exonic
1163561542 19:18022220-18022242 CAGAAAGTGGGGCAGGGAGCCGG - Intergenic
1163831535 19:19549471-19549493 CAGGACAGGAGGCAGCTGGCGGG - Intergenic
1164583696 19:29451723-29451745 CTGAACATGGGAAAGGTAGCTGG + Intergenic
1164684055 19:30155677-30155699 CAGGACGGGGAGCAGGTGGCTGG - Intergenic
1164847063 19:31441511-31441533 CAGGGTATGGGGCAGGTGACAGG - Intergenic
1165831371 19:38732191-38732213 CACAGCAGGTGGCAGGTGGCAGG - Intronic
1166288247 19:41845525-41845547 TTGAAAGTGGGGCAGGTGGCGGG + Intronic
1167484758 19:49755704-49755726 GATAAAATGGGCCAGGTGGCTGG + Intronic
1167720441 19:51176268-51176290 CAGGACAGTGGGGAGGTGGCTGG - Intergenic
1168492186 19:56820516-56820538 CAAACCAAGGGCCAGGTGGCTGG - Intronic
925101487 2:1250166-1250188 CAGAGGAAGGGGCAGGAGGCTGG - Intronic
926777385 2:16435973-16435995 CAGAAAAACAGGCAGGTGGCTGG - Intergenic
927517559 2:23681030-23681052 CAAAACATGGGGCAGGGAGGAGG + Intronic
927887480 2:26727563-26727585 CACAAGGTGGGGGAGGTGGCGGG + Intronic
928088125 2:28358371-28358393 GAGAACCTGGTGCAGGTGGAAGG + Intergenic
929239590 2:39640075-39640097 TGGAGCAGGGGGCAGGTGGCAGG + Intergenic
930721397 2:54641673-54641695 CAGGGAATGGGGCAGGGGGCGGG - Intronic
931240798 2:60450637-60450659 CAGAGCATGGGGCAGGGAGAGGG + Intergenic
932213832 2:69953371-69953393 CAGCACATGGGGTGGGTGCCTGG + Intergenic
932233558 2:70102711-70102733 CAGCAGGTGGGGCAGGAGGCCGG - Intergenic
933840754 2:86284068-86284090 CAGGCCAAGGGGGAGGTGGCTGG + Intronic
934298370 2:91761193-91761215 ATGAACACGGGGCAGGGGGCAGG + Intergenic
935673381 2:105574121-105574143 CAGAGCAGAGGGAAGGTGGCTGG - Intergenic
935931032 2:108125801-108125823 CAGAACATAGGCCAGATGGTGGG - Intergenic
936568167 2:113595913-113595935 CAGCACATGGGCCAGGAGCCAGG + Intergenic
937013284 2:118580997-118581019 CAGAACAGGGGGCAGGATGGAGG - Intergenic
938225220 2:129609983-129610005 AAATACATGGGGCTGGTGGCTGG - Intergenic
938373933 2:130791890-130791912 GAGAGCATGGGGCAGGTGCAGGG - Intergenic
939488109 2:142842614-142842636 TAGAAAATAGGGCAGGTAGCAGG - Intergenic
940031057 2:149261718-149261740 CAGTGCATGAGGCAGGTGTCAGG - Intergenic
940116939 2:150219555-150219577 GAGCAGATGGGGGAGGTGGCGGG + Intergenic
940418965 2:153456106-153456128 CACATGATGGGGCAGGGGGCGGG + Intergenic
941616494 2:167726367-167726389 CTGGACAAGGGGCAGGTGGGCGG - Intergenic
941719649 2:168799773-168799795 AAGGACAAGGAGCAGGTGGCTGG - Intronic
941856188 2:170233643-170233665 CAGAAGATGGGGCTGGGGCCAGG + Intronic
942552805 2:177137362-177137384 CAGAAGATGGGGAAAGGGGCTGG - Intergenic
943406979 2:187501296-187501318 CAGGACATGGGGCGGGGGGAGGG - Intronic
943556207 2:189407322-189407344 AAGAATATGGGGGAGGTGGAGGG + Intergenic
943581350 2:189687128-189687150 CAGAAGCTGGGAAAGGTGGCAGG - Intronic
943788532 2:191905958-191905980 AAGAACATGAGGCAGGTGAATGG + Intergenic
945130153 2:206562546-206562568 CAGAATGTGGGGCTGGGGGCAGG + Intronic
945691159 2:213037846-213037868 CAGAAAGTGGGCCAGGTGCCAGG + Intronic
946100205 2:217314119-217314141 CAGAACAAGAGGAAGGGGGCTGG - Intronic
946167762 2:217875855-217875877 CAGAACCGGGGGCTGGTGACAGG - Intronic
947551727 2:231051310-231051332 CAGAGCAAGGGGCTGGGGGCGGG - Intergenic
948310404 2:236981538-236981560 CAGAGGATGGGGCCCGTGGCTGG - Intergenic
1169011284 20:2252945-2252967 CAAGCCATGGGGCAGGGGGCAGG + Intergenic
1169068477 20:2707635-2707657 CAGGACAAAGGTCAGGTGGCTGG - Intronic
1169144095 20:3241123-3241145 CAGGACAGGAGGCAGGTGGGAGG - Intergenic
1169486493 20:6038568-6038590 CAGAGAAGGGGGCATGTGGCTGG + Exonic
1169775327 20:9245774-9245796 CAGGACATGTGGCATGTGCCTGG - Intronic
1170033405 20:11966003-11966025 CAGAAAAGGTGTCAGGTGGCAGG - Intergenic
1171460839 20:25297067-25297089 CAGGACAGAGGGCAGGGGGCAGG - Exonic
1172161220 20:32869593-32869615 CAGAATATGGCACAGGTGACAGG - Intronic
1173472591 20:43335338-43335360 TAAAACATGGTGCTGGTGGCTGG + Intergenic
1173551931 20:43938468-43938490 CAGGACATGGGGCAGGAGCCAGG - Intronic
1173617809 20:44414273-44414295 CAGAGGAGGGGGCAGGGGGCAGG + Intronic
1174000736 20:47372727-47372749 CAGAACATGGGGCAGGGCAGAGG - Intergenic
1174183376 20:48688902-48688924 CAGGTGGTGGGGCAGGTGGCAGG - Intronic
1174211100 20:48878632-48878654 CAGAAAAAGGGGAATGTGGCCGG - Intergenic
1174567390 20:51475394-51475416 GCGAGCAGGGGGCAGGTGGCAGG - Intronic
1174696582 20:52565604-52565626 CAGTACAAGGGTGAGGTGGCTGG + Intergenic
1175606459 20:60315703-60315725 GAGTACCTGGGGCAGGTGTCAGG - Intergenic
1175727818 20:61331651-61331673 GTGAGCCTGGGGCAGGTGGCTGG - Intronic
1178676261 21:34634218-34634240 CCGGACTTGGGGCAGGTGGGAGG - Intergenic
1178868534 21:36351461-36351483 CAGGACATGGGACAGGTAGTGGG - Intronic
1178879173 21:36434949-36434971 CAGAATATGGGGGACTTGGCAGG - Intergenic
1178882777 21:36462007-36462029 CAGAACTTCCGGCAGGTGGCTGG - Intronic
1179732132 21:43373864-43373886 CCGAGCAGGGGCCAGGTGGCCGG - Intergenic
1179880449 21:44291374-44291396 CAGACCGGGAGGCAGGTGGCAGG - Intronic
1181090858 22:20471597-20471619 AAGAACCTGGCGCTGGTGGCAGG + Intronic
1181477894 22:23180120-23180142 CGGAACATGAGGTAGGTGGTGGG + Intronic
1181478396 22:23182029-23182051 CGGAACATGCGGTAGGTGGTGGG - Exonic
1181536525 22:23549133-23549155 CTGCACATGGGGTAGGGGGCAGG + Intergenic
1181873993 22:25925606-25925628 CAGAAACTTGAGCAGGTGGCTGG + Intronic
1182769537 22:32784251-32784273 TAGAACATGGCGCAGGTGACAGG + Intronic
1184361298 22:44020468-44020490 CAGAAGTGGTGGCAGGTGGCTGG - Intronic
1184417186 22:44359206-44359228 CAGAGCCAGGGGGAGGTGGCGGG + Intergenic
1184419559 22:44371768-44371790 CAGGACAGGGTGCAGGTGTCTGG - Intergenic
1185045251 22:48525443-48525465 CAGAAGGCGGAGCAGGTGGCAGG - Intronic
1185078193 22:48694585-48694607 CAGCACATGGGGCAGGGAGGAGG - Intronic
1185089772 22:48759315-48759337 CAGATCACGGGCCAGGTGGCAGG + Intronic
1185104283 22:48858409-48858431 CAGAGCAAGGTGCTGGTGGCAGG - Intergenic
1185317191 22:50184310-50184332 CAGAACCTGGGGCTGGGGCCGGG + Intergenic
1185417451 22:50718041-50718063 CAGGGCATGGGGCAGGGGCCTGG - Intergenic
952815365 3:37442718-37442740 CAGACCCTGGGGCATGTGGAGGG + Intergenic
954111640 3:48436871-48436893 CAGAACATGGGGGTGGGGGACGG - Intronic
954115389 3:48464371-48464393 CAGAATAGGGGGCTGGAGGCAGG + Intronic
956310026 3:67868802-67868824 CAGGACATGGGGCAGGGGTTGGG + Intergenic
957523037 3:81345564-81345586 CAGAATAAGGGGAAGGTGGATGG + Intergenic
960255172 3:115504002-115504024 CAGAAAATGGGGGTGGTGGATGG - Intergenic
960991220 3:123312951-123312973 CTGAACATGGGGCAGGAGGGAGG + Intronic
961291341 3:125849284-125849306 CAGAAGATGGGCCAGGGGCCAGG - Intergenic
961895830 3:130167064-130167086 CAGAAGATGGGCCAGGGGCCAGG + Intergenic
962316249 3:134361279-134361301 CTGGACATGGGCCAGGTGGCAGG + Intronic
963009799 3:140758612-140758634 CAGGAAATGGGGCTGGTGCCAGG + Intergenic
966805867 3:183807044-183807066 CAGACCCTGGGGTTGGTGGCAGG - Exonic
966933563 3:184691309-184691331 CTGAGCATAGGGCAGGCGGCAGG - Intergenic
967829805 3:193909297-193909319 CAGGAGCTGGGGCAGGAGGCAGG + Intergenic
968047061 3:195630410-195630432 CAGAAGCTGGTGGAGGTGGCAGG - Intergenic
968233556 3:197017966-197017988 CTGAGCAGGGGGCAGGGGGCAGG + Intronic
968307588 3:197659634-197659656 CAGAAGCTGGTGGAGGTGGCAGG + Intergenic
968451978 4:680194-680216 CAGCACGTGGGGCAGGAGGGCGG - Intronic
968726423 4:2250004-2250026 GAGCACCTGGGGCAGGTGGGTGG - Exonic
968961173 4:3744453-3744475 CAGAACCTGGGGTAGGTAGCCGG + Intergenic
969464729 4:7349498-7349520 CGGGTCATGGGGCAGGGGGCTGG + Intronic
969490995 4:7499250-7499272 CACCACATGGGGCAGGTCGGGGG + Intronic
969746946 4:9080056-9080078 CAGAACATGGGCCAGGGGCCAGG - Intergenic
972731363 4:41798470-41798492 CAAAAGATGGGCCAGGTGGGAGG + Intergenic
975984556 4:80190301-80190323 AAGAACATGGGAAATGTGGCGGG + Intronic
976382672 4:84418121-84418143 GAGAACAACAGGCAGGTGGCAGG + Intergenic
983526697 4:168767311-168767333 CAGAACAGGGGAGAAGTGGCTGG - Intronic
985534340 5:455178-455200 CAGCCCATGAGGCAGGAGGCAGG + Intronic
985769231 5:1798753-1798775 CAGCAGATGGGGCAGGAGGCCGG + Exonic
986371879 5:7088143-7088165 CAGCACCTGGAGCAGATGGCTGG + Intergenic
986824070 5:11501711-11501733 CATAAGAAGGGGCAGGAGGCTGG + Intronic
987002671 5:13675973-13675995 ATGAACAGGAGGCAGGTGGCAGG + Intergenic
987303819 5:16619151-16619173 GAGAACATGGGGCAGGAGAGAGG + Intergenic
988893905 5:35651042-35651064 TGGAACATGGGCCAAGTGGCCGG - Intronic
990313917 5:54566637-54566659 ATGAACATGGGACAGGTGGAAGG - Intergenic
990931299 5:61095151-61095173 GAGAACATGGGCAGGGTGGCTGG + Intronic
992139227 5:73779589-73779611 AGACACATGGGGCAGGTGGCTGG + Intronic
993493686 5:88583691-88583713 CGGAACAGGTGGCAGCTGGCTGG - Intergenic
993615890 5:90111868-90111890 AAGAAAATGTGGCAGGTGGGAGG - Intergenic
996266349 5:121545560-121545582 CAGAAGATGGGGCTGGAGGTGGG - Intergenic
996882595 5:128317069-128317091 CAGTGCAAGGGGCATGTGGCAGG - Intronic
997223877 5:132194460-132194482 CAGAAGATGAGGCTGGAGGCTGG - Intronic
997434282 5:133863073-133863095 CAGAAATAGGGGAAGGTGGCAGG - Intergenic
998383318 5:141741460-141741482 CAGAACTGGGGCCAGGGGGCTGG - Intergenic
999317639 5:150594500-150594522 CAGATCCAGGGGCAGGTGGAGGG - Intergenic
1000440437 5:161256845-161256867 CAGAAAAAGTGGGAGGTGGCTGG - Intergenic
1001889430 5:175326874-175326896 CAGAGGATGGGGCTGGAGGCTGG - Intergenic
1001971216 5:175956498-175956520 CAGGACAGGGGACAGGTGGGGGG - Intronic
1002192010 5:177483337-177483359 CAGAATTTGAGGCACGTGGCAGG - Intergenic
1002246226 5:177887279-177887301 CAGGACAGGGGACAGGTGGGGGG + Intergenic
1002398443 5:178976210-178976232 CAGAGAATGGGGCAGCTGGCGGG - Intergenic
1002795094 6:465631-465653 AAGAGGATGGGGCAGGTGGCGGG - Intergenic
1004193093 6:13481388-13481410 CAGAAAAGAGGCCAGGTGGCCGG + Intronic
1004518048 6:16337299-16337321 CAGGACATCGGCCATGTGGCTGG + Intronic
1007197327 6:40074007-40074029 CAGAAGCTGTGGCAGGTGGGGGG - Intergenic
1007513388 6:42391765-42391787 CAGAACATGGAGCAGTGGGCTGG + Intronic
1007711729 6:43828352-43828374 CAGCCAATGGGGCAGGGGGCAGG + Intergenic
1007784598 6:44272399-44272421 CAGAACATGGGGAATGAGACTGG + Intronic
1008754074 6:54772956-54772978 CAAATCATGGGGCATGTGGAAGG - Intergenic
1010472124 6:76241283-76241305 CATAACACGAGGCAGGTAGCAGG + Intergenic
1010800100 6:80165432-80165454 CGAAACATGGGGCAGGTGTTGGG - Intronic
1012295080 6:97512367-97512389 GAGAAAATGGGGTAGGTGCCTGG + Intergenic
1012520170 6:100111800-100111822 CAGGATATGGGCCAGGAGGCTGG + Intergenic
1013294566 6:108747299-108747321 CAGGACCTGGGGCAGGGGGATGG - Intergenic
1014222247 6:118809476-118809498 CAGAACGTGGGGCTGCTGGGAGG + Intergenic
1015640126 6:135322861-135322883 CTGTGCATGAGGCAGGTGGCAGG + Intronic
1015979240 6:138822253-138822275 CATTACATGGGGAAGGAGGCCGG + Intronic
1017409853 6:154156527-154156549 CAGAGCATGGGGCAGCGGGAGGG + Intronic
1017720039 6:157237416-157237438 GAGAGCAGGGGCCAGGTGGCAGG - Intergenic
1017813315 6:157999669-157999691 CAGAAATTGGGGCAGGTGGTGGG + Intronic
1017894526 6:158667785-158667807 CAGAACAAGAGGCCTGTGGCAGG + Intronic
1018057708 6:160066884-160066906 CCAAACCAGGGGCAGGTGGCAGG - Intronic
1018472891 6:164112220-164112242 CAGAAGAGGGGGCAGGTGCCTGG + Intergenic
1018916654 6:168136541-168136563 CAGAGCATGGGGAAGGTTGCAGG + Intergenic
1019557823 7:1641366-1641388 CCACACATGGGGCAGGGGGCAGG - Intergenic
1019722673 7:2582676-2582698 CAGAACACGGGGCGGAAGGCAGG - Intronic
1020326505 7:6978513-6978535 CAGAAGATGGGCCAGGCGCCAGG + Intergenic
1023337653 7:39186935-39186957 CAGAACACAGAGCAGGCGGCAGG - Intronic
1025871768 7:65440960-65440982 CAGTGCAGGGGGCAGGTGTCTGG - Intergenic
1026111917 7:67465279-67465301 AAGACCATGGGGTAGGTGGGTGG - Intergenic
1029481226 7:100814124-100814146 CAGTACAGGGGACAGGTGGAGGG + Intronic
1030230336 7:107201964-107201986 CAGAACATGGGGCAGGTGGCTGG + Exonic
1032023153 7:128421323-128421345 TAGAACAGAGGGCAGGGGGCAGG + Intergenic
1033232948 7:139616031-139616053 CAGACCATGGGGAATGTGGAGGG - Intronic
1033674002 7:143519851-143519873 CAGCACACTGGGCAGGTGGGCGG - Intergenic
1034996583 7:155581135-155581157 CAGAACAATAGGCAGGTGCCCGG - Intergenic
1035933326 8:3809095-3809117 CAGAGCATGTGCCCGGTGGCAGG - Intronic
1036506344 8:9359946-9359968 CGTCACACGGGGCAGGTGGCTGG + Intergenic
1036708158 8:11060137-11060159 CAGAGCTTGGGGAGGGTGGCAGG + Intronic
1036776468 8:11616256-11616278 TAAGACATGGGGCAGGGGGCTGG + Intergenic
1037802860 8:22044570-22044592 CTGAACCTGGGCCAGGAGGCGGG + Intronic
1037819069 8:22127104-22127126 CAGAACAGGGGGCTGGGGGTTGG - Exonic
1037922256 8:22815734-22815756 TAGAACAGGTGGCAGGTGACAGG - Intronic
1038005242 8:23424351-23424373 TAGAACATGAGCCAGGGGGCAGG - Intronic
1039797034 8:40924521-40924543 CAGAACAGAGGGCAGGTGGCTGG + Intergenic
1040618459 8:49063334-49063356 TATGACATGGGGCAGGTGGAAGG - Intronic
1042596138 8:70450261-70450283 CAGAAGGTGGGGCATGTGGGAGG + Intergenic
1042958158 8:74273979-74274001 CAGAACAAGTGGCAAATGGCAGG - Intronic
1043418089 8:80071914-80071936 CAGGAGATGGGGCAGGTGCTGGG - Intronic
1045532809 8:103000657-103000679 CAGACCCTGGGGCATGTGGAGGG - Intergenic
1045742219 8:105374743-105374765 AGGAACATAGGGCAGGTAGCAGG + Intronic
1046365728 8:113228645-113228667 CAGAATATGTGGGAGGTGGGAGG - Intronic
1048274610 8:133056918-133056940 CAGAACCTGGGGATGGTGGAAGG - Intronic
1048496511 8:134940277-134940299 CAGGGCAGGGGGCAGGTGGGGGG + Intergenic
1049039949 8:140105037-140105059 CAGTCCTGGGGGCAGGTGGCTGG - Intronic
1049048344 8:140170884-140170906 AAGAACCTCGGGCAGGTGACTGG + Intronic
1049212644 8:141393747-141393769 CAGAACATGGTGAGGGTGGCTGG + Intronic
1049368826 8:142253805-142253827 CACAACATGGGCCACGTGCCGGG - Intronic
1049605874 8:143528967-143528989 CAAAACATGAGGCAGGAGGAAGG + Intronic
1049672923 8:143877746-143877768 CTGATCATGGTGCAGGTTGCAGG - Intronic
1050282182 9:4061962-4061984 TAAAAAATGGGGAAGGTGGCAGG + Intronic
1050517621 9:6461387-6461409 CAGAACAAGGGGCGGGGGGGAGG - Intronic
1051668565 9:19488235-19488257 CAGAACAAGGGGAAGCTGGTGGG - Intergenic
1052997163 9:34557249-34557271 CAGAACATGCAGCAGGGGGAAGG - Intronic
1053144865 9:35705506-35705528 AGGAACAAGGGGCAGGGGGCAGG + Intronic
1055388437 9:75791146-75791168 CAAAGCATGGGGCAGGGGGATGG - Intergenic
1056712373 9:89001267-89001289 CAGTACGTGGGGAAGTTGGCGGG + Exonic
1056790278 9:89620771-89620793 CTGACCTTGGGGCAGGTTGCTGG + Intergenic
1056846967 9:90046675-90046697 CAGCACATGGGGCCCGTGGGTGG + Intergenic
1057483132 9:95461421-95461443 CAGAATTTGGGGTAGGTGGGTGG - Intronic
1057719110 9:97518081-97518103 GAGAAGATGGGGCAGGTGTTGGG - Intronic
1060219711 9:121757972-121757994 CAGGGTATGGGGCAGGTGCCAGG - Intronic
1060522875 9:124303754-124303776 CAGGACATGGTGCTGATGGCTGG + Intronic
1060629646 9:125143793-125143815 GAGAACCTGGGGCAGGTGTCTGG - Intergenic
1061055969 9:128223081-128223103 CAGCCCAGGGCGCAGGTGGCCGG + Intronic
1061840572 9:133356530-133356552 CAGAACCTGGAGCCGGGGGCGGG - Exonic
1062126949 9:134869110-134869132 CAGAGCAGGGGCCAGGCGGCCGG - Intergenic
1062527890 9:136985616-136985638 CAAAACAAGGAGCAGGTGGGCGG - Exonic
1062715256 9:138007021-138007043 GAGAACATTCTGCAGGTGGCCGG + Intronic
1185543198 X:920555-920577 CAGAACATGAGGCAGGGAGCCGG - Intergenic
1186769209 X:12801124-12801146 CAAAACAAGTGGCTGGTGGCTGG + Intronic
1189914487 X:45843346-45843368 AAGAACATGGGGCAGTGGGAGGG + Intergenic
1190291388 X:48995055-48995077 CAGAACATAGAGCATGTGGTGGG + Intronic
1190311800 X:49122272-49122294 CAGGAGAAGGGGCAGGTGGCGGG + Intronic
1191603910 X:63041289-63041311 CAGATTATGTGGCAGCTGGCTGG - Intergenic
1194754324 X:97719817-97719839 TACAAAATGGGGCAGTTGGCTGG + Intergenic
1196283868 X:113856978-113857000 GAGAACCTGGGGCGGGGGGCGGG - Intergenic
1197613565 X:128666167-128666189 CTGAATATGGGGCCTGTGGCTGG + Intergenic
1197704317 X:129622971-129622993 CAGAACCTGGGGCAGGGGAGAGG - Intergenic
1198161267 X:134010970-134010992 CAGAGCAGGGGGCAGGTGTCTGG + Intergenic
1198414928 X:136410354-136410376 CTGAACATGGTGCTGGTGGGAGG + Intronic
1200108026 X:153725197-153725219 CAGCAGTTGAGGCAGGTGGCTGG - Exonic
1200229104 X:154435257-154435279 ATGAACCTGGGGAAGGTGGCAGG - Exonic
1201647181 Y:16247928-16247950 CAAAACATGGTGTAGATGGCTGG + Intergenic
1201655630 Y:16337374-16337396 CAAAACATGGTGTAGATGGCTGG - Intergenic
1201788919 Y:17816457-17816479 CAGAGGAGAGGGCAGGTGGCTGG + Intergenic
1201812634 Y:18089530-18089552 CAGAGGAGAGGGCAGGTGGCTGG - Intergenic
1201902432 Y:19057336-19057358 CAGAACAAGGTGTGGGTGGCAGG + Intergenic
1202096134 Y:21249660-21249682 CAGTACATGAGGCAGGAAGCAGG + Intergenic
1202350525 Y:23985532-23985554 CAGAGGAGAGGGCAGGTGGCTGG + Intergenic
1202520254 Y:25684589-25684611 CAGAGGAGAGGGCAGGTGGCTGG - Intergenic