ID: 1030231036

View in Genome Browser
Species Human (GRCh38)
Location 7:107208756-107208778
Sequence ACATACGCCCAGAGGGCCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 115}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030231032_1030231036 -3 Left 1030231032 7:107208736-107208758 CCGAGCTAATCTTTATCCACACA 0: 1
1: 0
2: 0
3: 14
4: 171
Right 1030231036 7:107208756-107208778 ACATACGCCCAGAGGGCCAGTGG 0: 1
1: 0
2: 1
3: 4
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030231036 Original CRISPR ACATACGCCCAGAGGGCCAG TGG Intronic
901158870 1:7159840-7159862 ACATTTGTCCAGAAGGCCAGGGG - Intronic
903035138 1:20487876-20487898 ACAGAAGTCCAGAGGGCCAGGGG + Intergenic
903932384 1:26870341-26870363 ACACACGTCCAGATGTCCAGAGG + Intergenic
904970806 1:34418208-34418230 CCAAACGCCCAGAAGGCGAGGGG - Intergenic
906311766 1:44759500-44759522 ACATATGACCCCAGGGCCAGAGG + Intronic
906558600 1:46736008-46736030 ACATATGGCCAGAGGCTCAGAGG + Intergenic
907552442 1:55315811-55315833 ACTGAGGCCCAGAGGGCCAGGGG - Intergenic
908960871 1:69695627-69695649 TCATAGGCCCAGAGGTCTAGTGG + Intronic
912444863 1:109727554-109727576 ATATACATCCAGAGGGCCTGAGG - Intronic
913529532 1:119723893-119723915 AGATAAGCCCTGAGGGCCAGGGG - Intronic
919086814 1:192930037-192930059 ACAGACGCCCAGGGGGAAAGAGG + Intergenic
920669697 1:207993844-207993866 ACAAATGCCCAGAGAGCCATCGG + Intergenic
923501439 1:234568522-234568544 ACACATGCCAAGAGGGTCAGAGG + Intergenic
1066682976 10:37953251-37953273 AAATACGCCCAGTGGAGCAGGGG - Intronic
1067814656 10:49464584-49464606 TCACAGGCCCAGAGGCCCAGGGG + Intronic
1072481275 10:95811124-95811146 ACATAACCCCAGAGGGGCAGAGG + Intronic
1076863726 10:133157021-133157043 ACACACGCACAGAGGGACGGGGG + Intergenic
1077336838 11:2009086-2009108 AGACACACCCAGAGGTCCAGGGG - Intergenic
1082266190 11:50121133-50121155 ACATGCTCACAGAGGGTCAGGGG + Intergenic
1082289899 11:50357439-50357461 ACATGCTCACAGAGGGTCAGGGG - Intergenic
1083162149 11:60861173-60861195 AGATGCTCCCAGAAGGCCAGTGG - Intergenic
1083686119 11:64376340-64376362 TCAAATGCCTAGAGGGCCAGAGG - Intergenic
1083902465 11:65650291-65650313 ACATATGCCTAGAAGACCAGCGG + Intronic
1085514550 11:77104799-77104821 ACAGATGCACTGAGGGCCAGAGG + Intronic
1088920914 11:114259327-114259349 ACACACACGCAGAGGCCCAGTGG + Intronic
1089633287 11:119796616-119796638 ACAGGAGCCCAGAGGGGCAGGGG + Intergenic
1089965590 11:122652600-122652622 ACATCCTCTCAGATGGCCAGAGG - Intergenic
1202819822 11_KI270721v1_random:64268-64290 AGACACACCCAGAGGTCCAGGGG - Intergenic
1091451443 12:574769-574791 ACATACCCCCAGAAGGCCAGTGG + Intronic
1093768731 12:22995983-22996005 CCCTACTCCCAGAGGGCCTGTGG + Intergenic
1097247750 12:57615890-57615912 ACTGACCTCCAGAGGGCCAGAGG + Exonic
1098944445 12:76574035-76574057 TCATAGGCCCAGAGGCCTAGTGG - Intergenic
1099429980 12:82571776-82571798 ACATACACCCAGAGGAGCACAGG + Intergenic
1099584326 12:84497452-84497474 CCATAGGCCCACAGGGCCACAGG + Intergenic
1108206395 13:48094775-48094797 ACCGCCGCCCAGAGTGCCAGAGG + Intronic
1113053910 13:106246395-106246417 CCATAAGCACAGAGGGACAGAGG + Intergenic
1113758812 13:112833376-112833398 ACTGAAGCCCAGAGGCCCAGCGG + Intronic
1114646668 14:24259894-24259916 ACATACACCCAGAGGAGCTGGGG - Intronic
1115027503 14:28761556-28761578 AAATACCACCAGAGGGCCAAGGG - Intergenic
1117181909 14:53200264-53200286 TCACAGGCCCAGAGGCCCAGGGG + Intergenic
1117298191 14:54397466-54397488 ACCTGCGCCCACAGGGCCTGGGG + Intronic
1119386380 14:74260237-74260259 ATATAGGCCCAGAGGGCAGGTGG - Intronic
1128153133 15:65376106-65376128 ACCAACACCCAGAGTGCCAGAGG - Intronic
1129297404 15:74607354-74607376 ACATATACCCAGAGAGACAGGGG - Intronic
1135259557 16:20969161-20969183 ATATACACCCAAAGGGACAGGGG - Intronic
1136412524 16:30085658-30085680 AGATGGGCCTAGAGGGCCAGTGG + Intergenic
1137567463 16:49542539-49542561 ACACATGGCCAGAAGGCCAGAGG + Intronic
1138536793 16:57664396-57664418 ACAAAGGCCCAGATGGACAGAGG - Exonic
1141303482 16:82839268-82839290 ATCTAAGCCTAGAGGGCCAGGGG - Intronic
1141555729 16:84835500-84835522 ACTTCAGCCCAGAGGGCCTGGGG - Intronic
1151376110 17:73690227-73690249 AAATACCCCCATATGGCCAGCGG + Intergenic
1152516066 17:80825646-80825668 ACAGAGGCCCAGAGAGCCTGGGG + Intronic
1152647327 17:81475481-81475503 TCAGAGGCCCAGAGGCCCAGAGG + Intergenic
1152780738 17:82226467-82226489 CCAGACCCCCAGCGGGCCAGGGG + Intergenic
1154173765 18:12068396-12068418 ACGTACGCCAAGAGGGGCAAGGG - Intergenic
1159643169 18:70887597-70887619 TCATAGGCCCAGAGGTCTAGGGG + Intergenic
1165811173 19:38612751-38612773 AGACACGCTCAGAGAGCCAGAGG + Intronic
1168476188 19:56677110-56677132 ACATACTCCCAGAGGACCCATGG - Intergenic
925429381 2:3778065-3778087 ACATGCGTCCAGCTGGCCAGGGG - Intronic
927317888 2:21706803-21706825 ACATGTGGCCAGAGGGCCATGGG + Intergenic
929383198 2:41377861-41377883 ATATACATCCAGATGGCCAGAGG + Intergenic
932817035 2:74870333-74870355 ACATAGCCACAGATGGCCAGTGG + Intronic
933070857 2:77856880-77856902 TCACAGGCCCAGAGGGCTAGGGG + Intergenic
936800339 2:116258134-116258156 TCATAGGCCCAGAGGCCTAGGGG - Intergenic
939429592 2:142085894-142085916 ATATATGCCCAGAGCTCCAGAGG - Intronic
939556453 2:143679959-143679981 ACATTCTCACAGAAGGCCAGGGG + Intronic
940373315 2:152925593-152925615 CCACATGCCCAGAGGGCCAAGGG - Intergenic
940495632 2:154424516-154424538 AAAGACCCCCAGAGGGTCAGAGG - Intronic
944364869 2:198906233-198906255 ACCTAATCCCAAAGGGCCAGAGG + Intergenic
944428712 2:199610651-199610673 ACACACACCCCGAGAGCCAGAGG - Intergenic
945992796 2:216410577-216410599 ACATATGCTAAGAGGGCCTGTGG - Intergenic
948590957 2:239049870-239049892 GCAGACGCCAAGAGGCCCAGTGG + Exonic
1172123185 20:32610453-32610475 CCATGGGCCCAGAGGCCCAGAGG - Intergenic
1174118317 20:48243064-48243086 ACACACGCTCAGAGGCTCAGAGG + Intergenic
1175277540 20:57782519-57782541 GGATGCGCCCAGTGGGCCAGCGG - Intergenic
1175837210 20:62003907-62003929 GCATGCTCCCCGAGGGCCAGGGG + Intronic
1179235347 21:39540615-39540637 TCACAGGCCCAGAGGCCCAGGGG - Intergenic
1181457553 22:23068308-23068330 ACATGCCCCCAGAGCCCCAGTGG + Intronic
1181462903 22:23095760-23095782 ACCTGCGCTCAGAGAGCCAGCGG + Exonic
1181673305 22:24436163-24436185 CCACATGCCCAGAGGCCCAGGGG - Intronic
1181868086 22:25875151-25875173 ACATGAGCACAGAAGGCCAGTGG - Intronic
1182047511 22:27287305-27287327 ACACACACACAGAGGACCAGAGG + Intergenic
1182959471 22:34458497-34458519 ACAGACCACCAGAGGCCCAGTGG - Intergenic
1184610092 22:45597872-45597894 ACATAAGCCCAGAGAGCGAAAGG + Intronic
949598450 3:5573041-5573063 AAATACTCTCAGAGGGTCAGAGG + Intergenic
950174514 3:10863493-10863515 ACATGCACACAGAGTGCCAGAGG + Intronic
952944398 3:38467959-38467981 ACTTAAGCCTAGAGGGGCAGTGG - Intronic
954227495 3:49191694-49191716 AGGTACAACCAGAGGGCCAGGGG + Intronic
966564239 3:181358611-181358633 ACATACCCACAGAGTGGCAGAGG - Intergenic
967035871 3:185647823-185647845 GCATCAGGCCAGAGGGCCAGAGG - Intronic
967060326 3:185866512-185866534 ACATTCTCCCAGAGGTCCCGTGG - Intergenic
970078746 4:12255240-12255262 ACATTTGCACAGATGGCCAGGGG - Intergenic
970083156 4:12313554-12313576 ACATAAGCCTAGGGGGACAGAGG - Intergenic
971243167 4:24906823-24906845 GCAGACAGCCAGAGGGCCAGAGG + Intronic
972598700 4:40552771-40552793 AGAAACGGCCAGAAGGCCAGTGG - Intronic
975669113 4:76762486-76762508 AGATAAGCCCACAGGGCAAGTGG - Intronic
983457786 4:167986109-167986131 ACATACCACCAGAGGACCTGAGG - Intergenic
983581286 4:169312227-169312249 ACATAGCCCCAGGGAGCCAGTGG + Intergenic
986556449 5:9014779-9014801 ACATTTGCCCAGTGGGCCCGGGG - Intergenic
998483102 5:142479407-142479429 ACAGAGTCCCAGAGGGCCAAGGG + Intergenic
998889307 5:146729544-146729566 TCACAGGCCCAGAGGCCCAGGGG + Intronic
1001400231 5:171442044-171442066 ACATGAGCTCAGAGGGGCAGGGG - Intronic
1002452197 5:179325483-179325505 ACCCACTCCCAGAGGGTCAGAGG + Intronic
1002459670 5:179367104-179367126 ACCGAGGCCCAGAGGGGCAGGGG - Intergenic
1002704264 5:181149455-181149477 GCATCCCCCCAGATGGCCAGTGG - Intergenic
1004588347 6:17025218-17025240 TCATAGGCCCAGAGGCCTAGAGG + Intergenic
1006388974 6:33747640-33747662 GCAGAGGCCCAGAGGCCCAGAGG + Intergenic
1006388977 6:33747648-33747670 CCAGAGGCCCAGAGGCCCAGAGG + Intergenic
1013542160 6:111121864-111121886 TTATAAGCCCAGTGGGCCAGTGG + Intronic
1018935762 6:168273359-168273381 TCATTCACACAGAGGGCCAGGGG - Intergenic
1030231036 7:107208756-107208778 ACATACGCCCAGAGGGCCAGTGG + Intronic
1033264940 7:139876873-139876895 AGATACACCCAGAAGTCCAGCGG - Intronic
1037595448 8:20350525-20350547 AGAGAGGGCCAGAGGGCCAGAGG + Intergenic
1038632336 8:29257910-29257932 ATATATGCACATAGGGCCAGAGG - Intronic
1048327400 8:133450182-133450204 AAATACGCACTGAGGGCCATGGG - Intergenic
1052975351 9:34406045-34406067 ACAGAAGCCCAGAGGGCAGGTGG - Intronic
1060036747 9:120262291-120262313 ACCAATGCCCAGATGGCCAGAGG + Intergenic
1060482693 9:124026501-124026523 ACATCCACCCAGAGGGCATGTGG + Intronic
1061407525 9:130400714-130400736 ACTCACGGCCACAGGGCCAGGGG - Intronic
1062232045 9:135487178-135487200 ACACGCAGCCAGAGGGCCAGGGG + Exonic
1192713412 X:73615700-73615722 ACACACTACCAGAGGGCCTGAGG - Intronic