ID: 1030236180

View in Genome Browser
Species Human (GRCh38)
Location 7:107265193-107265215
Sequence ACTTGACCAAAGGAAGGATT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 214
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 187}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030236180 Original CRISPR ACTTGACCAAAGGAAGGATT TGG Intronic
901947019 1:12712291-12712313 ACGTGAGTAGAGGAAGGATTTGG + Intergenic
907450738 1:54544206-54544228 GCTTGCCCAGAGGAAGGGTTTGG - Intronic
907746277 1:57216844-57216866 ACTTGACGTAAGGCAGGACTGGG + Intronic
908069597 1:60443823-60443845 CCTTAGCCAAAGGAAGGATCAGG - Intergenic
910790775 1:91047802-91047824 CCTTGAACAAAGTAAGGATCCGG + Intergenic
910929811 1:92432026-92432048 ACTTGACAAAAACAAGGAATGGG - Intergenic
911196536 1:95000645-95000667 ATTTGAACAAAGAAAGCATTTGG - Intronic
915807460 1:158869584-158869606 ACCTGACAAAAGCAAGGAATGGG + Intergenic
917926058 1:179789996-179790018 ACATGACCAAAGAATGGTTTAGG + Intronic
918532789 1:185541524-185541546 ACTTGCCCAAAGTAAGGGTTAGG + Intergenic
918829446 1:189374118-189374140 ACCTGACAAAAGCAAGCATTGGG - Intergenic
919131009 1:193450453-193450475 ATTTGCCCAAAGGAAGGAGATGG - Intergenic
919683294 1:200456802-200456824 AATTAACCAAAGTAAAGATTTGG + Intergenic
919705955 1:200676140-200676162 ACTTTAGCAAAGGAAGGCTCAGG + Intergenic
923871766 1:238002936-238002958 ACTTGACAAAAAGAAGCAATGGG + Intergenic
924603754 1:245514649-245514671 TCCTGACCAGAGGAAGGACTTGG + Intronic
1064944970 10:20777386-20777408 ATATGTACAAAGGAAGGATTTGG - Intergenic
1065820348 10:29519366-29519388 ATTTTACCAAAGGAGGGATTCGG - Intronic
1065952670 10:30666174-30666196 ATTTTACTAAAGGAGGGATTCGG + Intergenic
1067154233 10:43762364-43762386 ACTTCACCAAAGGATAGATGAGG - Intergenic
1068493145 10:57749506-57749528 ACCTGACAAAAGGAAGCAATGGG - Intergenic
1072909556 10:99487672-99487694 ACTAGACAAAAGGAAGAACTGGG - Intergenic
1073818034 10:107229083-107229105 ACCTGACAAAAAGAAGGAATGGG + Intergenic
1074239485 10:111622726-111622748 TCTTGACCAAAGCAAAGACTAGG + Intergenic
1077303341 11:1856994-1857016 TCTTGACCACAGGAAGGTGTAGG - Intronic
1077647076 11:3934872-3934894 GCTTGACCCAAGGAATGAGTAGG + Intronic
1079047539 11:17119577-17119599 ACTAGCCTAAAGGAAGGGTTAGG - Intronic
1080060499 11:27951553-27951575 AGATGACAAATGGAAGGATTGGG - Intergenic
1081716817 11:45256350-45256372 AGATGAGCAAAGGAAGGATTGGG - Intronic
1081760092 11:45571078-45571100 ACTTCACCAAGGGGAGGCTTAGG + Intergenic
1081989059 11:47327877-47327899 GCTTGGCCAGAGGAAGGAGTAGG - Intronic
1082088409 11:48068802-48068824 ACATGAGCAAAGTGAGGATTAGG - Intronic
1086210877 11:84317158-84317180 AGCTGACCAAAGGAAAGAGTAGG - Intronic
1086345849 11:85895354-85895376 ACTGGACCAAAAGAAGGAATGGG + Exonic
1087931148 11:103979320-103979342 AGCTGACCCAAGGAAGGAGTGGG - Intronic
1089222921 11:116890128-116890150 ACTTGACCATAATAAGCATTTGG - Intronic
1089646393 11:119882629-119882651 TCATGACCAAAGGAAGGAAGCGG - Intergenic
1090093769 11:123724203-123724225 CCTTGAGGAAAGGAAGGGTTGGG - Exonic
1090324184 11:125870636-125870658 ACGTGAACAGAAGAAGGATTTGG + Intergenic
1092514837 12:9199537-9199559 AATTGCCCAGAGGAAAGATTAGG + Intronic
1093516645 12:19994768-19994790 ATATGACCAAAGAAAGAATTTGG + Intergenic
1094211071 12:27892317-27892339 AATCAACCAAATGAAGGATTGGG - Intergenic
1094493196 12:30974057-30974079 CCTTGACAAAAGGAAGGATCAGG - Intronic
1096766796 12:53897696-53897718 ACTTGACCAAAGAAATTACTGGG - Intergenic
1099932058 12:89086268-89086290 GCTTGAGGAAAGGAAGGATTTGG + Intergenic
1100903575 12:99271810-99271832 ACTGGAGTGAAGGAAGGATTGGG + Intronic
1101335896 12:103796594-103796616 ACTTGGCCAAAGGGATGATGGGG - Intronic
1102353215 12:112210259-112210281 AGGAGACCAAATGAAGGATTTGG + Intronic
1107896871 13:44974146-44974168 ACTTGACCAAAGAGAAGTTTAGG - Intronic
1108214779 13:48173451-48173473 AATTGAAAGAAGGAAGGATTTGG + Intergenic
1108721060 13:53132728-53132750 ACATGATCAAAGAAAGGTTTTGG + Intergenic
1109317847 13:60772355-60772377 ACTTGACAAAAATAAGCATTAGG - Intergenic
1109580375 13:64323616-64323638 AGTTGACCAAAGTAAGCAATGGG - Intergenic
1114967681 14:27983520-27983542 CCTTGAACAATGCAAGGATTAGG - Intergenic
1116634881 14:47382079-47382101 ACCTGACAAAAAGAAGGAATGGG + Intronic
1116772662 14:49145221-49145243 ACCTGACAAAAAGAAGGAATGGG - Intergenic
1120512730 14:85435045-85435067 ACTAGACCAAAGAATGGCTTAGG - Intergenic
1121073534 14:91047164-91047186 TCTGGACCAAGGCAAGGATTAGG - Intronic
1121410562 14:93745828-93745850 ACTTGCCCAAAGTCAGGATCTGG - Intronic
1125967584 15:43886774-43886796 ACTAGGCCAAAGGCAGGACTAGG + Intronic
1127630590 15:60823859-60823881 ACTTGACCTAAAGAAGCAGTAGG - Intronic
1128538093 15:68505566-68505588 CCTTGAAAGAAGGAAGGATTTGG + Intergenic
1128586102 15:68851638-68851660 ACTTGATAAAAGGAAGAAATGGG + Intronic
1130758581 15:86793245-86793267 ACTTGACCAAAAGAATATTTAGG + Intronic
1130889859 15:88124517-88124539 CCTTGACCAAAGGGAAGAATGGG - Intronic
1135471650 16:22736631-22736653 GCTGGACCAAAGAAAGGGTTAGG - Intergenic
1135603132 16:23800395-23800417 ACTTGACTAAATGAAGGCTTAGG + Intergenic
1143008536 17:3852856-3852878 ACTAGACCAAGGGAAGGAGGGGG - Intergenic
1144616199 17:16775970-16775992 ACCTGACAAAAGGAAGCAATGGG - Intronic
1144896506 17:18539691-18539713 ACCTGACAAAAGGAAGCAATGGG + Intergenic
1145135712 17:20404530-20404552 ACCTGACAAAAGGAAGCAATGGG - Intergenic
1146967803 17:37047685-37047707 ACCTGACCAAAAGAACGAATTGG + Intronic
1149123554 17:53199670-53199692 ACATGAAGAAAGGAAGGATTCGG - Intergenic
1150305733 17:64083880-64083902 ACTTGGACAAAGGAAAGATGTGG - Intronic
1151523473 17:74647761-74647783 ACTTGACCAAGGGAAGGAGATGG - Intergenic
1155432619 18:25776625-25776647 ACCTGACAAAAGGAAGCAATGGG + Intergenic
1155999676 18:32371132-32371154 GCATGACCAAAGGAAGGACGTGG + Intronic
1156949552 18:42878140-42878162 CCTTGACCAATGCAAGGGTTGGG + Intronic
1157066877 18:44360233-44360255 ACTTGACAAAAAGAAGAAGTGGG - Intergenic
1157694472 18:49709928-49709950 CCTTGACCAAACCAAGGGTTGGG - Intergenic
1159717343 18:71841953-71841975 AATTGAGCAAGGGAAGGATCCGG + Intergenic
1161904332 19:7144103-7144125 AATTGTCCAAAGGAAGCAGTGGG - Intronic
1164206117 19:23060268-23060290 CCTTGACAAAAAGAGGGATTGGG - Intergenic
1164426299 19:28144985-28145007 AAATGAGCAAAGGATGGATTGGG - Intergenic
1164990469 19:32678936-32678958 TCTGGACCACAGGCAGGATTTGG - Intergenic
1166063900 19:40345343-40345365 ACTTGTCCAGAGTCAGGATTAGG - Intronic
1166416236 19:42596425-42596447 ACTAGGCCCAGGGAAGGATTGGG + Intronic
1166820567 19:45576827-45576849 ATGTGATCAAATGAAGGATTTGG - Intronic
925121600 2:1422455-1422477 ACTTCACCAAAGGAATGAATTGG - Intronic
927529594 2:23782397-23782419 ACTTGAATACAGGATGGATTAGG + Intronic
928498071 2:31855549-31855571 ACTTGAGAATATGAAGGATTTGG + Intergenic
928511266 2:32006195-32006217 AAATGATCAAAGGAATGATTTGG + Intronic
928822292 2:35375913-35375935 GTTTGACCAAAGGAAGGAAAAGG + Intergenic
930459839 2:51659340-51659362 ATTTGGCAAAAGGAAGAATTGGG + Intergenic
932234084 2:70107308-70107330 AAATGAGCAAAGGAAGGATTTGG + Intergenic
932954972 2:76341012-76341034 CCTTGAGCAAAGGAGGGATTAGG + Intergenic
933407920 2:81885611-81885633 AATTGAGAACAGGAAGGATTGGG - Intergenic
933799743 2:85951282-85951304 AATTGACCAAACGAAAGATGAGG + Intergenic
935099695 2:99981514-99981536 ACTTGAAAAAGTGAAGGATTGGG - Intronic
936675481 2:114709149-114709171 ATTTGACCAAAGGGAGGCATTGG + Intronic
936887541 2:117331056-117331078 ACTTGAGCAAAGGAGGTGTTGGG - Intergenic
939003644 2:136762803-136762825 AAGTGAACAAAGAAAGGATTTGG - Intergenic
940263158 2:151806294-151806316 ACTTAAACAAAAGAAGGATTGGG - Intronic
941402096 2:165044130-165044152 ACTATATCAAAGGAAAGATTTGG + Intergenic
942255977 2:174098392-174098414 ACATGAGAAAAGGAAGGATCGGG + Intronic
942371617 2:175291896-175291918 GATTAACCAAGGGAAGGATTTGG - Intergenic
944703055 2:202262640-202262662 ACTTGACCAAATAAAGTAATTGG - Intergenic
944852630 2:203735526-203735548 TTTTGACCAAATGAGGGATTTGG + Exonic
945080330 2:206081925-206081947 ACTTGCCCAGCGGAAGGACTGGG + Intronic
946053028 2:216880012-216880034 ACAGGACCAAAGGAAAGATGGGG - Intergenic
947702315 2:232244647-232244669 AATTGGCCAAAGGAAGGAGCTGG + Intronic
947976807 2:234373689-234373711 ACTTGACTAACAGAAGGTTTAGG - Intergenic
1169866087 20:10201675-10201697 ACTGGACCAAAGGAAAGCCTTGG - Intergenic
1171351585 20:24506930-24506952 TCTAGAATAAAGGAAGGATTTGG + Intronic
1172824122 20:37765875-37765897 ACTTTACAAAAGGAAAGACTGGG - Intronic
1174033738 20:47652420-47652442 ACTCGACCAAAGGCTGGATCTGG - Exonic
1174084720 20:47998810-47998832 ACTTGACCAAGGGACGGAGCAGG + Intergenic
1174545518 20:51322364-51322386 ACCTGGCCAGAGGAAGGATCTGG - Intergenic
1178159867 21:29899690-29899712 AGGTGACCAGAGGGAGGATTTGG + Intronic
1179924514 21:44526916-44526938 ATTTGAGGAAAGGAAGGATCAGG + Intronic
1182889128 22:33802063-33802085 ACATGTGCAAAGGAATGATTTGG + Intronic
1182889226 22:33802826-33802848 TCTTGTGCAAAGGAAGGATTTGG - Intronic
949764585 3:7512060-7512082 ACTTGAACCCAGGAAGGAATTGG + Intronic
950404929 3:12798306-12798328 TCTTGACCCCAGGCAGGATTAGG + Intronic
951685668 3:25341514-25341536 AGTTTACCAAAGGAAGGGTTGGG + Intronic
952515380 3:34098937-34098959 ACTTGACAAAAAGAAGAAATGGG + Intergenic
952986089 3:38785357-38785379 ACTTGACAAAAGCAAGCAATGGG + Intronic
955853593 3:63248221-63248243 ACTTGCCCAAAGTCAGCATTTGG - Intronic
955924131 3:63989247-63989269 AGATGACCAAAGAAAGGACTTGG - Intronic
959011789 3:101085971-101085993 ACTTCTCCAAAGAAAGAATTGGG + Intergenic
959933867 3:112010343-112010365 AAATGAGCAAAGGAAGGCTTAGG - Intronic
962270410 3:133974065-133974087 ACCAGACCAAAGGAAGTATCTGG + Intronic
963486148 3:145936434-145936456 ATTTGGCCAAAGGAAGGCATGGG + Intergenic
964377581 3:156064471-156064493 ACCTGACAAAAGCAAGCATTGGG - Intronic
965527360 3:169735217-169735239 ACTTGACAAAAAGAAGAAATAGG + Intergenic
969796142 4:9530032-9530054 ACATAACCAGAGGATGGATTTGG + Intergenic
970093157 4:12432087-12432109 ACTTAACCAAAGGGATGACTTGG - Intergenic
973687010 4:53380818-53380840 TCTTGACCAACTGAAGGAATGGG - Intronic
975002277 4:69239248-69239270 TATTGACCAAAGCAAGCATTAGG - Intergenic
975662084 4:76698314-76698336 TCTTGGGCAAAGTAAGGATTAGG + Intronic
979274700 4:118802166-118802188 AATTGACCACACGAAGGATGAGG + Intronic
979809935 4:125024838-125024860 AATTGATCAAAGGAAGGAGTTGG - Intergenic
979918609 4:126471571-126471593 ACATGAACACAGAAAGGATTTGG + Intergenic
983298587 4:165897491-165897513 ACTTGACAAAAACAAGCATTGGG - Intronic
983358830 4:166701866-166701888 ACTTGACCAAAAAAAGCAATGGG - Intergenic
984276228 4:177613215-177613237 AGTAGACCCAAGGAAGGATCTGG - Intergenic
984453574 4:179936344-179936366 CCTTGAACAATGCAAGGATTAGG + Intergenic
986937119 5:12902937-12902959 ACTTGATGAAAGGAGAGATTTGG - Intergenic
987126387 5:14816869-14816891 ATGTGACCAAAGGAAGGACCAGG + Intronic
989785072 5:45317292-45317314 ACTTGACAAAAACAAGAATTGGG + Intronic
990387849 5:55285723-55285745 ACTTTTTCAAAGGAAGGATTTGG + Exonic
994048080 5:95331551-95331573 CTGTGACCAAAGGAATGATTTGG + Intergenic
995062025 5:107821535-107821557 ACATGACCAGAGGAAGGGCTAGG - Intergenic
995785551 5:115823828-115823850 ACCTGACAAAAGGAAGCAATGGG - Intergenic
997688843 5:135811752-135811774 ATTTTACCAAAGGAAGAATTGGG - Intergenic
997800375 5:136854734-136854756 AATTGACCAAATGTTGGATTTGG - Intergenic
1002979961 6:2126462-2126484 ACTTGACCAAAAGCTGGAATTGG + Intronic
1005230490 6:23696392-23696414 ACTTCACCCAAAGAATGATTTGG + Intergenic
1008443672 6:51562206-51562228 AATTAACTAAAGGAAGGCTTTGG + Intergenic
1010446519 6:75954878-75954900 ACTTGACAAAAGCAAGCAATGGG - Intronic
1012286820 6:97400565-97400587 CCTTGAACAAAGAAAGGGTTAGG + Intergenic
1012642733 6:101640325-101640347 TCTTGGCCACAGCAAGGATTTGG - Intronic
1012711522 6:102613017-102613039 AGTTGATCAAAGGAAGCATTCGG + Intergenic
1013397617 6:109758333-109758355 ACTTGACAAAAGCAAGTAATGGG + Intronic
1015116730 6:129657890-129657912 AATAGCCCAAAGTAAGGATTAGG - Intronic
1015918452 6:138242496-138242518 TCTTGGCCATAAGAAGGATTAGG - Intronic
1017585994 6:155923693-155923715 CCTTGAACAAAGGAGGGAATAGG - Intergenic
1024134478 7:46392530-46392552 AGTTGGCCATAGGAAGGAATTGG - Intergenic
1030236180 7:107265193-107265215 ACTTGACCAAAGGAAGGATTTGG + Intronic
1030720909 7:112869070-112869092 CTTTGACCCAAGGAAGGCTTTGG - Intronic
1031544780 7:123037479-123037501 ACTTGCCCAAAGCAAGAATTAGG - Intergenic
1032838399 7:135694807-135694829 TCTTGACCAATGGGAGCATTGGG + Intronic
1032999076 7:137482873-137482895 CCTTGTCCTAAGGAAGGATATGG + Intronic
1033207623 7:139436458-139436480 ACTAGTCCCAAGGAAGGACTGGG - Intergenic
1034386266 7:150743685-150743707 ACTTGCTCAAAGGAAGCATGTGG - Exonic
1036105043 8:5829583-5829605 ACGTGAGCAGAGGAAGGATGTGG + Intergenic
1038586389 8:28793024-28793046 ACTTTACAAAAGCAAGGGTTGGG + Intronic
1040669538 8:49672800-49672822 ACCTGACCAAAGCAAGCAATGGG + Intergenic
1043027921 8:75094248-75094270 ACTTGACAAAAGCAAGCAATGGG - Intergenic
1044130738 8:88521171-88521193 ACTTCACCAGAGGAAGGAGTAGG - Intergenic
1044222284 8:89683227-89683249 ACTTGACAAAAGCAAGGAATGGG + Intergenic
1045515051 8:102852121-102852143 GCATGACCAAAGGTAGGATGGGG - Intronic
1045965364 8:108018383-108018405 TGTTGACCTAAGGAAGGTTTGGG - Intronic
1046322976 8:112602249-112602271 ACTTGAACAAATAAAGGGTTAGG + Intronic
1046480100 8:114805467-114805489 AATTCACCAAAGGAAAAATTGGG + Intergenic
1047377017 8:124309301-124309323 TCTTGAACAATGGAGGGATTAGG - Intergenic
1048522866 8:135172883-135172905 ACTGAACCAAATCAAGGATTGGG + Intergenic
1049754073 8:144300756-144300778 CCTGGAGCAGAGGAAGGATTGGG + Intronic
1050619622 9:7439215-7439237 AATTGACCAAAAGAAGAAATTGG + Intergenic
1052290939 9:26839948-26839970 CCTTAACAAAAGGAAGGAATCGG + Intergenic
1052748326 9:32463293-32463315 ATTTGTCCAAAGGAAAGAATGGG - Intronic
1056291130 9:85144842-85144864 TCTAGAGCAAAGGAAGGAATGGG + Intergenic
1056331105 9:85522116-85522138 AGTTGTCCAAAGGAATGAGTTGG - Intergenic
1058774195 9:108267844-108267866 AATAGATCAGAGGAAGGATTGGG - Intergenic
1059806510 9:117806850-117806872 ACTAGACTAAAGGCAGGATTTGG - Intergenic
1060867235 9:127010127-127010149 ACTTGACCAAACAAGGAATTTGG + Intronic
1203782351 EBV:107694-107716 ACCTGACCAAGGGCAGGATCAGG - Intergenic
1187525551 X:20051072-20051094 ATTTGAACAAAGGATGGATTTGG + Intronic
1187608187 X:20909809-20909831 TATTGATCAAAGGGAGGATTTGG + Intergenic
1188360258 X:29244346-29244368 ACTTGAACAAAGTAACTATTTGG + Intronic
1191177648 X:57522360-57522382 ACTTGACAAAAACAAGAATTGGG - Intergenic
1191879418 X:65829369-65829391 ACTATATCAGAGGAAGGATTTGG - Intergenic
1191947535 X:66552117-66552139 ACCTGACCAAAAGAAGGAATGGG - Intergenic
1192406939 X:70895747-70895769 ACTTGACAAAAGCAAGCAATGGG + Intronic
1192922030 X:75716916-75716938 ACTTGACAAAAAGAAGAAATGGG - Intergenic
1193354187 X:80498007-80498029 ACTTGACAAAAGCAAGAACTGGG - Intergenic
1195470276 X:105222014-105222036 ACATGATCATAGGAAAGATTAGG - Intronic
1196237851 X:113303661-113303683 ACTGGAGCAAAGGAAGTATTTGG - Intergenic
1197385629 X:125797689-125797711 ACTTGACCAAAAAAAGCAATGGG + Intergenic
1198650030 X:138852430-138852452 ACTTGACAAAAACAAGGAGTTGG + Intronic
1198721873 X:139631087-139631109 ACTTGAAGAAATGAAGGGTTTGG - Intronic
1199318692 X:146412461-146412483 ACTTGACAAAAACAAGGAATGGG + Intergenic
1200683421 Y:6239572-6239594 ACTTGTCCAAAAAAAGGTTTGGG + Intergenic
1201049213 Y:9914813-9914835 ACTTGTCCAAAAAAAGGTTTGGG - Intergenic