ID: 1030248078

View in Genome Browser
Species Human (GRCh38)
Location 7:107407735-107407757
Sequence TGAATACAAAACAAACAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1927
Summary {0: 1, 1: 0, 2: 4, 3: 78, 4: 1844}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030248078 Original CRISPR TGAATACAAAACAAACAGCC AGG Intronic
900032269 1:380566-380588 TGCATAGAAAACAAACACTCTGG - Intergenic
900273212 1:1805160-1805182 TCAAAAGAAAACAAACAGGCCGG + Intronic
900424587 1:2570333-2570355 GGAGGACAAAACAAAGAGCCAGG + Intergenic
900683822 1:3934158-3934180 AAAATACAAAAGAAATAGCCGGG - Intergenic
901107343 1:6767155-6767177 AAAATACAAAACAATTAGCCAGG - Intergenic
901134991 1:6987321-6987343 AAAATACAAAATAATCAGCCGGG - Intronic
901351642 1:8602228-8602250 AAAATACAAAAAAATCAGCCAGG + Intronic
901358040 1:8669234-8669256 AGAATACAAAAAAATTAGCCGGG - Intronic
901379236 1:8861985-8862007 AAAATACAAAACAATTAGCCAGG + Intronic
901391290 1:8948003-8948025 AAAATAAAAAACAATCAGCCGGG - Intronic
901429589 1:9205069-9205091 AAAATACAAAACAATTAGCCGGG - Intergenic
901466826 1:9427076-9427098 AAAATACAAAAAAAATAGCCGGG - Intergenic
901604374 1:10447817-10447839 AAAATACAAAAAAATCAGCCGGG + Intronic
901901871 1:12371549-12371571 AAAATACAAAAAAATCAGCCAGG - Intronic
902500797 1:16910348-16910370 AAAATACAAAACAATTAGCCAGG + Intronic
902591691 1:17479627-17479649 TGAATACAGCACAGACAGCTGGG + Intergenic
902823771 1:18958668-18958690 AGAATACAAAAAAATTAGCCGGG - Intergenic
902901905 1:19523281-19523303 TGAAAGTAAAAGAAACAGCCTGG + Intergenic
902959083 1:19949412-19949434 GGCATAAAAAACAAACAGCCAGG + Intergenic
903048269 1:20581046-20581068 AAAATACAAAAAAAATAGCCGGG - Intergenic
903206305 1:21784828-21784850 AAAATACAAAAAAAATAGCCGGG + Intergenic
903305873 1:22412781-22412803 AGAATACAAAACACAAGGCCTGG - Intergenic
903374771 1:22858975-22858997 TGTATACAAAAAAATTAGCCCGG + Intronic
903465961 1:23553002-23553024 AAAATACAAAAAAAATAGCCAGG + Intergenic
903473751 1:23605558-23605580 AAAATACAAAAAAAATAGCCAGG + Intronic
903484633 1:23680566-23680588 AAAATACAAAAAAAATAGCCGGG - Intergenic
903714854 1:25357796-25357818 AAAATACAAAAAAAATAGCCAGG - Intronic
903895515 1:26600889-26600911 AAAATACAAAAAAATCAGCCGGG + Intergenic
903928160 1:26846485-26846507 AAAATACAAAAAAATCAGCCGGG - Intronic
904182981 1:28679964-28679986 AAAATACAAAACAATTAGCCAGG - Intronic
904206413 1:28858272-28858294 AAAATACAAAAAAAATAGCCGGG - Intronic
904409820 1:30318792-30318814 TGAATATAAAAGAAAAAGCAGGG - Intergenic
904635092 1:31873816-31873838 AAAATACAAAAAAATCAGCCAGG + Intergenic
904712460 1:32440806-32440828 TGAAGACAAAAAATACAGGCTGG + Intergenic
904726237 1:32550456-32550478 AAAATACAAAAAAAATAGCCAGG + Intronic
904770824 1:32880424-32880446 AAAATACAAAACAATTAGCCGGG + Intergenic
905083670 1:35349667-35349689 AAAATACAAAAAAACCAGCCAGG + Intronic
905088472 1:35406529-35406551 TAAAAATAAAACAAAAAGCCGGG + Intronic
905141896 1:35853088-35853110 AAAATACAAAAAAATCAGCCGGG + Intronic
905357182 1:37392757-37392779 TGAAAAAAAAAAAAATAGCCTGG + Intergenic
905628269 1:39503195-39503217 AAAATACAAAAAAAATAGCCAGG + Intronic
905674207 1:39814042-39814064 TAAATACAAAAAAATTAGCCGGG - Intergenic
906304085 1:44705330-44705352 AGAATACAAAAAAATTAGCCAGG + Intronic
906379124 1:45320566-45320588 TTAATACAAAAAAATCAGCCAGG - Intergenic
906404461 1:45530651-45530673 AAAATACAAAAAAAATAGCCAGG + Intergenic
906410904 1:45578071-45578093 AAAATACAAAAAAAATAGCCAGG + Intergenic
906486089 1:46236180-46236202 TAAATACAAAAAAATCAGCTGGG - Intergenic
906860513 1:49353987-49354009 TGGATACAAAAAAAAGACCCAGG + Intronic
906969527 1:50496726-50496748 TAAATACAAAAAAATCAGCCGGG + Intronic
907215847 1:52862942-52862964 AAAAAACAAAAAAAACAGCCAGG - Intronic
907432053 1:54418271-54418293 TAAATACAAAAAAATTAGCCAGG + Intergenic
907432718 1:54422992-54423014 AAAATACAAAAAAAATAGCCAGG + Intergenic
907624262 1:56012620-56012642 AAAATACAAAAAAAATAGCCAGG + Intergenic
907794387 1:57700303-57700325 TTAATACAAAACAAAAACCTTGG + Intronic
907935225 1:59035787-59035809 AGAATACACAAAAATCAGCCAGG + Intergenic
908252822 1:62278551-62278573 AAAATACAAAAAAAATAGCCAGG - Intronic
908362965 1:63388075-63388097 AAAATACAAAAAAAATAGCCGGG - Intronic
908532562 1:65047556-65047578 AAAATACAAAACAATTAGCCGGG + Intergenic
908610794 1:65857980-65858002 TGAATACAAAAGAAAGCTCCAGG - Intronic
908839147 1:68261117-68261139 TGAAAATACAAAAAACAGCCAGG - Intergenic
909004797 1:70263552-70263574 TGAGTACAAATCATAAAGCCTGG + Intronic
909202294 1:72705799-72705821 TAAATTCAAATCAAACAGCTGGG - Intergenic
909452971 1:75819151-75819173 TGAAGACAAGACAAAGAGCGAGG - Intronic
909539713 1:76777450-76777472 TGCATACAAAACAAAAATCCAGG - Intergenic
909698990 1:78499411-78499433 TGAACACAGAACAATCAGCAAGG - Intronic
910012359 1:82481107-82481129 TGAAAACAAAACAAGAAACCAGG + Intergenic
910134944 1:83956586-83956608 AAAATACAAAACAATTAGCCAGG - Intronic
910234035 1:85016380-85016402 AAAATACAAAAAAAATAGCCAGG + Intronic
910401487 1:86842246-86842268 AAAATACAAAAAAAATAGCCCGG + Intergenic
910527900 1:88202050-88202072 AAAATACAAAAAAAATAGCCAGG + Intergenic
910641439 1:89467298-89467320 TGAAAAAAAAAAAAACAGCATGG + Intergenic
911126609 1:94346623-94346645 AAAATACAAAAAAATCAGCCGGG + Intergenic
911727813 1:101260578-101260600 AGAATAAAAAAAAAACAGCAGGG - Intergenic
911776137 1:101815284-101815306 AAAATACAAAAAAAATAGCCGGG + Intronic
911835861 1:102617852-102617874 AAAATACAAAAAAAATAGCCAGG - Intergenic
912214884 1:107598056-107598078 TAAATACAAAAACAAGAGCCAGG + Intronic
912233493 1:107822492-107822514 AAAATACAAAAAAAACAGCCGGG + Intronic
912350078 1:109004102-109004124 AAAATACAAAAAAATCAGCCAGG + Intronic
912675378 1:111675478-111675500 ACAAAACAAAAAAAACAGCCTGG + Intronic
913002250 1:114592557-114592579 AAAATACAAAAAAACCAGCCAGG + Intronic
913017263 1:114751838-114751860 TGAATACAAAAGATATAGCGAGG - Intronic
913072845 1:115316342-115316364 TGAGTGTAAAACAAACATCCAGG - Intronic
913331051 1:117668072-117668094 TTAATACAACACAATCAGCCAGG - Intergenic
913571668 1:120126307-120126329 AAAATACAAAACAATTAGCCGGG + Intergenic
913606370 1:120470279-120470301 TAAATACAAAAAAATTAGCCAGG + Intergenic
914194059 1:145435359-145435381 AAAATACAAAAAAAATAGCCAGG + Intergenic
914210063 1:145569859-145569881 TAAATACAAAAAAATTAGCCAGG - Intergenic
914268985 1:146062231-146062253 TAAATACAAAAAAATTAGCCAGG - Intergenic
914292589 1:146287928-146287950 AAAATACAAAACAATTAGCCGGG + Intergenic
914368111 1:146998633-146998655 TAAATACAAAAAAATTAGCCAGG + Intergenic
914475391 1:148018256-148018278 AAAATACAAAAAAAATAGCCAGG + Intergenic
914484869 1:148099572-148099594 TAAATACAAAAAAATTAGCCAGG - Intergenic
914553633 1:148738711-148738733 AAAATACAAAACAATTAGCCGGG + Intergenic
914584829 1:149051559-149051581 TAAATACAAAAAAATTAGCCAGG - Intergenic
914644998 1:149644547-149644569 AAAATACAAAAAAATCAGCCGGG + Intergenic
914863716 1:151407849-151407871 AAAATACAAAAAAATCAGCCAGG + Intronic
914909429 1:151772259-151772281 TAAATACAAAAAAATTAGCCAGG - Intronic
915115641 1:153597568-153597590 AAAATACAAAAAAATCAGCCGGG + Intergenic
915406226 1:155661814-155661836 AAAATACAAAAAAATCAGCCGGG - Intronic
915434657 1:155895042-155895064 AAAATACAAAAAAAATAGCCAGG - Intergenic
915437505 1:155919648-155919670 AAAATACAAAACAATTAGCCAGG + Intronic
915450064 1:155998578-155998600 AAAAAACAAAACAAACAGGCCGG - Intronic
915505975 1:156356852-156356874 TGAAGAGAAAACAATCAGCCAGG + Intronic
916421359 1:164640715-164640737 AAAATACAAAAAAATCAGCCAGG - Intronic
916454673 1:164958718-164958740 AAAATACAAAAAAAATAGCCGGG + Intergenic
916696079 1:167237938-167237960 AGAATACAAAAAAATTAGCCGGG - Intronic
916708327 1:167377424-167377446 AAAATACAAAAAAAATAGCCAGG + Intronic
916784286 1:168073013-168073035 TAAAAACAAAAAAATCAGCCGGG + Intronic
916896790 1:169171799-169171821 AGAAAAAAAAAAAAACAGCCAGG - Intronic
916980264 1:170128438-170128460 AAAATACAAAAAAAATAGCCGGG - Intergenic
917043447 1:170831505-170831527 TAAATACAAAAAAATTAGCCCGG + Intergenic
917435750 1:175019440-175019462 ACAAAACAAAAAAAACAGCCAGG - Intronic
917614466 1:176725938-176725960 AAAATACAAAACAATTAGCCAGG - Intronic
918063947 1:181086962-181086984 TTATTACAAAATAATCAGCCGGG - Intergenic
918426096 1:184411580-184411602 AAAATACAAAAAAAATAGCCAGG - Intronic
918917743 1:190666891-190666913 AAAATACAAAACAATTAGCCGGG - Intergenic
918988734 1:191668766-191668788 TGAAAACAAAACAGAAAGCCTGG + Intergenic
919035932 1:192309003-192309025 AAAATACAAAAAAATCAGCCAGG + Intergenic
919076348 1:192818125-192818147 AAAATACAAAACAATTAGCCAGG + Intergenic
919219070 1:194601766-194601788 AAAATACAAAACAATTAGCCAGG - Intergenic
919231449 1:194779776-194779798 AAAATACAAAAAAAATAGCCAGG - Intergenic
919231991 1:194785471-194785493 AAAATACAAAAAAAATAGCCGGG - Intergenic
919329245 1:196148092-196148114 AAAATACAAAAAAAATAGCCGGG - Intergenic
919402123 1:197131717-197131739 AAAATACAAAAAAATCAGCCAGG - Intronic
919408532 1:197214928-197214950 TAAAAACAAAACAAAAAGACTGG + Intergenic
919445755 1:197703146-197703168 TAAAAACAAAACAATTAGCCGGG - Intronic
919595979 1:199562895-199562917 AAAATACAAAAAAAATAGCCAGG + Intergenic
919637056 1:200013217-200013239 AAAATACAAAAAAATCAGCCAGG + Intergenic
920005349 1:202829348-202829370 TGAAAAGACAACAAACAGCATGG + Intergenic
920142858 1:203832217-203832239 AAAATACAAAAAAATCAGCCGGG - Intronic
920162955 1:204013748-204013770 TAAATACAAAAAAATTAGCCAGG + Intergenic
920236806 1:204512845-204512867 AAAATACAAAACAATTAGCCGGG - Intergenic
920317634 1:205090010-205090032 AAAATACAAAACAATTAGCCAGG - Intronic
920491328 1:206417576-206417598 AGAATACAAAAAAATTAGCCAGG - Intronic
920808852 1:209263103-209263125 AAAATACAAAAAAAATAGCCGGG - Intergenic
921106592 1:211986998-211987020 TTAAAACAAAACAACCAGCCTGG + Intronic
921222811 1:212985575-212985597 TAAAAACACAAAAAACAGCCGGG - Intronic
921229991 1:213059974-213059996 AAAATACAAAAAAATCAGCCGGG - Intronic
921395569 1:214665565-214665587 AAAATACAAAAAAAACTGCCAGG - Intergenic
921425509 1:214996884-214996906 TAAATACAAAAAAATTAGCCGGG + Intergenic
922312990 1:224413968-224413990 AAAATACAAAAAAATCAGCCAGG - Intronic
922313169 1:224415619-224415641 AAAATACAAAAAAAATAGCCGGG - Intronic
922426596 1:225502368-225502390 AGAATACAAAAAAATTAGCCAGG - Intronic
922568117 1:226615259-226615281 AAAATACAAAAAAAAGAGCCAGG + Intergenic
922846665 1:228690615-228690637 TCAAAAAAAACCAAACAGCCGGG - Intergenic
922902967 1:229151770-229151792 AGAATACAAAAAAATTAGCCAGG + Intergenic
923381046 1:233418255-233418277 TGAAAACACAAAAATCAGCCAGG - Intergenic
923595773 1:235360095-235360117 TAAAAAAAAAACAAATAGCCAGG - Intergenic
923640211 1:235750002-235750024 TCAATACAAAAGAAACAGCAGGG + Intronic
923944710 1:238871449-238871471 AAAATACAAAAAAAAAAGCCGGG - Intergenic
923954821 1:239004448-239004470 AAAATACAAAAAAAATAGCCGGG + Intergenic
924356200 1:243178876-243178898 AAAATACAAAAAAAACAGCAGGG - Intronic
924572856 1:245253968-245253990 AAAATACAAAAAAATCAGCCGGG - Intronic
924722117 1:246633580-246633602 AAAATACAAAAAAATCAGCCAGG + Intronic
924726034 1:246671742-246671764 AAAATACAAAAAAAATAGCCGGG + Intergenic
924734588 1:246744477-246744499 AAAATACAAAAAAAATAGCCGGG - Intronic
924753779 1:246922820-246922842 AAAATACAAAAAAAATAGCCGGG + Intronic
924870589 1:248039580-248039602 TGATTAAAAAAAAAACAGGCAGG - Intronic
1062794552 10:334144-334166 AAAATACAAAAAAAATAGCCAGG + Intronic
1062898830 10:1126243-1126265 AAAATACAAAAAAATCAGCCAGG + Intronic
1063089460 10:2849484-2849506 AAAATACAAAAAAAATAGCCGGG - Intergenic
1063512570 10:6660396-6660418 AAAATACAAAACAATTAGCCAGG + Intergenic
1064085781 10:12345625-12345647 AGAATACAAAAAAATTAGCCGGG - Intergenic
1064113869 10:12561072-12561094 AAAATACAAAACAATTAGCCAGG - Intronic
1064132489 10:12722283-12722305 AAAATACAAAACAATTAGCCGGG + Intronic
1064214071 10:13384945-13384967 AAAATACAAAACAATTAGCCGGG - Intergenic
1064442554 10:15367036-15367058 AAAATACAAAAAAAATAGCCAGG + Intronic
1064462913 10:15552295-15552317 AAAATACAAAAGAAAAAGCCAGG - Intronic
1064509614 10:16075407-16075429 TTAAAACAAAAAACACAGCCAGG - Intergenic
1064542038 10:16414901-16414923 AAAATACAAAAAAAATAGCCGGG - Intergenic
1064595077 10:16935717-16935739 AAAATACAAAAAAATCAGCCAGG + Intronic
1064643944 10:17441471-17441493 TAAATACAAAACAATTAGCCAGG - Intronic
1064734758 10:18370456-18370478 AAAATACAAAACAATTAGCCGGG - Intronic
1064819551 10:19310647-19310669 TGAGTCCAAAACAAGAAGCCTGG - Intronic
1065243000 10:23727146-23727168 AAAATACAAAAAAAGCAGCCAGG - Intronic
1065359872 10:24879502-24879524 AAAATACAAAAAAATCAGCCGGG - Intronic
1065378126 10:25063017-25063039 AAAATACAAAAAAAATAGCCAGG - Intergenic
1065391495 10:25187123-25187145 AAAATACAAAAAAAATAGCCGGG - Intronic
1065573531 10:27096603-27096625 AAAATACAAAAAAAATAGCCAGG + Intronic
1065573767 10:27098707-27098729 AAAATACAAAAAAATCAGCCGGG - Intronic
1065868830 10:29938160-29938182 AAAATACAAAAGAAACAGCTGGG - Intergenic
1066066725 10:31766206-31766228 TGAAAACAAAGCCAACAGCTAGG + Intergenic
1066106013 10:32157635-32157657 AAAATACAAAAAAATCAGCCAGG + Intergenic
1066121259 10:32289782-32289804 AAAATACAAAAAAAATAGCCGGG - Intronic
1066153229 10:32647346-32647368 AAAATAGAAAAAAAACAGCCAGG + Intronic
1066353856 10:34663303-34663325 AAAATACAAAAAAAATAGCCAGG + Intronic
1066357834 10:34702002-34702024 AAAATACAAAACAATTAGCCGGG + Intronic
1066555091 10:36603563-36603585 AAAATACAAAAAAAATAGCCAGG - Intergenic
1066574625 10:36811755-36811777 TGAAAATAAAGAAAACAGCCTGG - Intergenic
1067377225 10:45738863-45738885 TAAATACAAAAAAATTAGCCAGG - Intronic
1067410250 10:46058258-46058280 AAAATACAAAAAAAATAGCCAGG - Intergenic
1067641870 10:48054672-48054694 AAAATACAAAAAAAATAGCCGGG - Intergenic
1067736590 10:48857950-48857972 AAAATACAAAACAATTAGCCAGG - Intronic
1067763773 10:49070090-49070112 AAAATACAAAAAAATCAGCCGGG + Intronic
1067838890 10:49660278-49660300 AAAATACAAAACAATTAGCCAGG + Intronic
1067851127 10:49755081-49755103 TGAAAACACAAAAATCAGCCAGG + Intronic
1067884932 10:50079555-50079577 TAAATACAAAAAAATTAGCCAGG - Intronic
1067998355 10:51301814-51301836 TGACTGCAAAACCAATAGCCAGG - Intronic
1068458580 10:57294024-57294046 AGATTATAAAACAAACGGCCGGG - Intergenic
1068683688 10:59847211-59847233 AAAATACAAAAAAATCAGCCCGG - Intronic
1068935381 10:62630944-62630966 TAAAAAAAAAACAAACAGGCCGG + Intronic
1069478383 10:68757899-68757921 AAAATACAAAACAATTAGCCGGG - Intronic
1069485429 10:68819551-68819573 AAAAAACAAAACAAAGAGCCGGG - Intergenic
1069489835 10:68851836-68851858 TGTCTTAAAAACAAACAGCCGGG + Intronic
1069779729 10:70947304-70947326 TGAATACACAAAAATTAGCCAGG + Intergenic
1070023694 10:72611140-72611162 TAAATACAAAAAAATTAGCCGGG + Intronic
1070178974 10:73996939-73996961 AAAATACAAAAAAAATAGCCAGG - Intergenic
1070199185 10:74186438-74186460 AAAATACAAAAAAAATAGCCAGG - Intronic
1070205770 10:74259615-74259637 AAAATACAAAAAAAATAGCCAGG - Intronic
1070228778 10:74541584-74541606 GGAATACCATAGAAACAGCCTGG + Intronic
1070272185 10:74966867-74966889 AAAATACAAAACAATTAGCCGGG + Intronic
1070366833 10:75744831-75744853 TGAATACATAGCAAAGAGCCTGG - Intronic
1071002348 10:80844344-80844366 AAAATACAAAACAATTAGCCAGG - Intergenic
1071009513 10:80921360-80921382 TAAAGAGAAAACAAAAAGCCTGG - Intergenic
1071102503 10:82055314-82055336 AAAATACAAAAAAAATAGCCAGG + Intronic
1071114626 10:82203149-82203171 TGAAGACACAGCAACCAGCCAGG + Intronic
1071428817 10:85587100-85587122 AAAATACAAAAAAAATAGCCGGG - Intergenic
1071520048 10:86324840-86324862 AAGATACAAAACAAACACCCAGG + Intronic
1071607919 10:87010406-87010428 AAAATACAAAACAATTAGCCAGG - Intergenic
1071695855 10:87869949-87869971 GGATTACAAAACAAGCAGTCTGG - Intronic
1071805484 10:89115943-89115965 TAAATACAAAAAAATTAGCCAGG - Intergenic
1071849457 10:89553833-89553855 AAAATACAAAACAATTAGCCAGG + Intronic
1071861838 10:89682206-89682228 TGACTATAAAAGAAACAGGCCGG + Intergenic
1071936014 10:90531238-90531260 AGAATACAAAAAAATTAGCCGGG + Intergenic
1072152998 10:92698514-92698536 TGAATACCAAACAATCACCCAGG + Intergenic
1072924364 10:99603564-99603586 AAAATACAAAACAATCAGCCGGG - Intergenic
1072971035 10:100017506-100017528 TAAATACAAAAAAATTAGCCGGG + Intergenic
1072972543 10:100029607-100029629 AAAATACAAAACAATTAGCCGGG + Intergenic
1073016340 10:100402595-100402617 TTAAAACAAAACAATAAGCCAGG + Intergenic
1073133063 10:101203072-101203094 AAAATACAAAAAAAATAGCCAGG + Intergenic
1073196702 10:101697266-101697288 AAAATACAAAACAATTAGCCGGG - Intergenic
1073303758 10:102486945-102486967 TGAAAAAAAAAAAAATAGCCGGG - Intronic
1073372598 10:103004161-103004183 TAAATACAAAAAAATTAGCCAGG - Intronic
1073422738 10:103437646-103437668 AAAATACAAAAAAAATAGCCGGG - Intronic
1073437926 10:103533085-103533107 AAAATACAAAAAAAATAGCCAGG - Intronic
1073553007 10:104420911-104420933 TAAATACAAAAAAATTAGCCGGG - Intronic
1073787094 10:106901592-106901614 AAAATACAAAACAATTAGCCAGG - Intronic
1074067302 10:110028271-110028293 AGTATATTAAACAAACAGCCTGG + Intronic
1074124694 10:110518896-110518918 AAAATACAAAAAAAATAGCCGGG - Intergenic
1074203087 10:111257184-111257206 TAAATACAAAAAAATTAGCCAGG + Intergenic
1074491948 10:113946329-113946351 TAAATACAAAAAAATTAGCCAGG + Intergenic
1074989525 10:118690885-118690907 AAAATACAAAACAATTAGCCAGG + Intronic
1075028047 10:119001451-119001473 TTAAAAAAAAACAAACAGGCTGG - Intergenic
1075109353 10:119565493-119565515 GGAATACAAAATATACGGCCAGG + Intergenic
1075142879 10:119855509-119855531 AAAATACAAAACAATTAGCCGGG + Intronic
1075367508 10:121905682-121905704 AAAATACAAAAAAATCAGCCGGG + Intronic
1075428892 10:122364285-122364307 TCCATCCAAAACAAACAGTCTGG + Intergenic
1075707834 10:124512454-124512476 AAAATACAAAACAAACAGCGGGG + Intronic
1075749202 10:124751279-124751301 AAAATACAAAAAAATCAGCCAGG - Intronic
1075810422 10:125220930-125220952 AAAATACAAAAAAAATAGCCGGG + Intergenic
1077051896 11:570392-570414 AAAATACAAAAAAATCAGCCGGG + Intergenic
1077064484 11:634404-634426 AAAATACAAAAAAATCAGCCGGG - Intergenic
1077194672 11:1273333-1273355 AAAATACAAAAAAATCAGCCGGG + Intergenic
1077237321 11:1488031-1488053 TCTCTACAGAACAAACAGCCCGG + Intronic
1077237761 11:1490112-1490134 AAAATACAAAAAAATCAGCCGGG + Intronic
1077277960 11:1725507-1725529 AAAATACAAAACAATTAGCCGGG + Intergenic
1077403516 11:2370467-2370489 AAAATACAAAAAAATCAGCCTGG - Intergenic
1077625761 11:3769881-3769903 AAAATACAAAAAAATCAGCCAGG + Intronic
1077638651 11:3861392-3861414 AAAATACAAAACAATTAGCCAGG - Intronic
1078169641 11:8919795-8919817 AAAATACAAAAAAAATAGCCGGG - Exonic
1078217772 11:9326161-9326183 AAAATACAAAACAATTAGCCAGG + Intergenic
1078395736 11:10980453-10980475 AAAATACAAAAAAAATAGCCGGG - Intergenic
1078425387 11:11245461-11245483 AAAATACAAAAAAAATAGCCAGG - Intergenic
1078675948 11:13414491-13414513 AGAATACAAAAAAATTAGCCGGG + Intronic
1079422051 11:20302589-20302611 TAAAAACAAAAAAAATAGCCGGG - Intergenic
1079902777 11:26208350-26208372 AAAATACAAAAAAAATAGCCGGG + Intergenic
1079992857 11:27265155-27265177 AAAATACAAAACAATTAGCCAGG + Intergenic
1080216927 11:29854333-29854355 AAACTACCAAACAAACAGCCAGG + Intergenic
1080306094 11:30838177-30838199 AAAATACAAAAAAAAAAGCCGGG - Intronic
1080454151 11:32403151-32403173 TGAGGAAAAAAAAAACAGCCAGG + Intronic
1080468875 11:32525863-32525885 TAAATACAAAAAAATTAGCCAGG + Intergenic
1080886116 11:36369753-36369775 AAAATACAAAACAATTAGCCAGG - Intronic
1080888566 11:36388857-36388879 AAAATACAAAAAAATCAGCCGGG - Intronic
1081377727 11:42379120-42379142 AGAAAACAAAAAAAAAAGCCGGG + Intergenic
1081386843 11:42481898-42481920 AAAATACAAAAAAATCAGCCAGG - Intergenic
1081735805 11:45403031-45403053 AAAATACAAAAAAAATAGCCGGG + Intergenic
1081928334 11:46849386-46849408 AAAATACAAAAAAATCAGCCAGG - Intergenic
1082019725 11:47522069-47522091 AAAATACAAAAAAATCAGCCAGG - Intronic
1082042514 11:47697704-47697726 AAAATACAAAAAAAATAGCCGGG - Intronic
1082098211 11:48148596-48148618 AAAATACAAAAAAAATAGCCAGG - Intronic
1082161171 11:48889336-48889358 TAAAAACACAACAATCAGCCAGG + Intergenic
1082256142 11:50035474-50035496 AAAATACAAAAAAATCAGCCAGG + Intergenic
1082641473 11:55666340-55666362 TGAATATAAAAAAATTAGCCGGG - Intergenic
1082660172 11:55899928-55899950 ACAATAAAAAACAAACGGCCGGG + Intergenic
1083181799 11:60991309-60991331 AAAATACAAAACAATTAGCCAGG - Intronic
1083258824 11:61512264-61512286 AAAATACAAAAAAATCAGCCGGG - Intergenic
1083315334 11:61811461-61811483 AAAATACAAAAAAATCAGCCAGG - Intronic
1083404951 11:62450316-62450338 CAAATACAAAAAAAATAGCCGGG - Intronic
1083409719 11:62483696-62483718 AAAATACAAAAAAAATAGCCAGG + Intronic
1083484520 11:62975063-62975085 TGAAAAAAAACCACACAGCCCGG - Intronic
1083656686 11:64233397-64233419 AAAATACAAAACAACTAGCCGGG - Intronic
1083748717 11:64749345-64749367 TCAAAACAAAACAAAAGGCCGGG + Intronic
1083829448 11:65222111-65222133 AAAATACAAAACAACTAGCCGGG - Intergenic
1083859118 11:65410493-65410515 TCAAAACAAAACAAAAGGCCGGG + Intronic
1083869044 11:65475865-65475887 AAAATACAAAAAAAATAGCCGGG - Intergenic
1083913567 11:65725467-65725489 TAAATATAAAAAAATCAGCCGGG - Intergenic
1083915861 11:65743454-65743476 AAAATACAAAAAAATCAGCCGGG - Intergenic
1083991515 11:66248891-66248913 ACAAAACAAAACAAAGAGCCAGG - Intergenic
1084023694 11:66434381-66434403 AAAATACAAAAAAATCAGCCAGG + Intergenic
1084093826 11:66897090-66897112 AAAATACAAAAAAATCAGCCAGG - Intronic
1084170779 11:67399974-67399996 AAAATACAAAAAAATCAGCCAGG + Intronic
1084327393 11:68409686-68409708 AGAATACAAAAAAATTAGCCAGG + Intronic
1084396297 11:68912879-68912901 AAAATACAAAACAATTAGCCGGG + Intronic
1084983849 11:72850221-72850243 AAAATACAAAACAATTAGCCAGG - Intronic
1085056923 11:73410245-73410267 AAAATACAAAACAATGAGCCAGG + Intronic
1085433095 11:76473465-76473487 AAAATACAAAAAAAATAGCCGGG - Intronic
1085589682 11:77748170-77748192 AGAATACAAAACAAGCAGTATGG + Intronic
1085628025 11:78088568-78088590 AAAAAACAAAACAAACAGCCGGG - Intergenic
1085671280 11:78466639-78466661 AAAATACAAAAAAAATAGCCGGG - Intronic
1086026203 11:82294930-82294952 GAAATACAAAACAATTAGCCAGG - Intergenic
1086036410 11:82420608-82420630 TAAATACAAAAAAATTAGCCAGG - Intergenic
1086259943 11:84927318-84927340 AGAAAACAAAACAAAAAGCAAGG - Intronic
1086313837 11:85568173-85568195 TAAATACAAAAAAATTAGCCAGG - Intronic
1086585739 11:88449169-88449191 AAAATACAAAAAAAATAGCCGGG - Intergenic
1086762145 11:90644721-90644743 TGAATAGACAAAAAACAGACTGG + Intergenic
1086896705 11:92321274-92321296 AAAATACAAAAAAAATAGCCAGG + Intergenic
1086955856 11:92934009-92934031 AAAATACAAAAAAAATAGCCAGG + Intergenic
1087733364 11:101803913-101803935 TGAAAAAAAAAAAAAAAGCCTGG + Intronic
1087943511 11:104129846-104129868 TAAATACAAAAAAATTAGCCAGG + Intronic
1088146286 11:106683896-106683918 TCTATACAAAACACAGAGCCTGG + Intronic
1088251330 11:107863431-107863453 TAAATACAAAAAAAGTAGCCTGG + Intronic
1088274724 11:108073039-108073061 AAAATACAAAAAAAATAGCCAGG + Intronic
1088335082 11:108694718-108694740 CAAATACAAAAAAATCAGCCAGG + Intronic
1088362805 11:109008930-109008952 AAAATACAAAAAAATCAGCCGGG - Intergenic
1088487349 11:110353536-110353558 AAAAAACAAAAAAAACAGCCAGG + Intergenic
1088800999 11:113307094-113307116 AAAATACAAAACAATTAGCCAGG - Intergenic
1089172256 11:116521022-116521044 TAAATACAAAAAAATTAGCCAGG + Intergenic
1089210225 11:116795395-116795417 AAAATACAAAAAAAATAGCCAGG + Intergenic
1089846194 11:121460554-121460576 AAAATACAAAACAATTAGCCGGG - Intronic
1089928289 11:122281944-122281966 AAAATACAAAAAAATCAGCCAGG + Intergenic
1089967828 11:122668144-122668166 AAAATACAAAAAAAATAGCCTGG - Intronic
1089991843 11:122868846-122868868 AAAATACAAAACAATTAGCCGGG + Intronic
1090030231 11:123200046-123200068 AAAATACAAAAAAATCAGCCGGG - Intergenic
1090666957 11:128920736-128920758 TGCCTCCCAAACAAACAGCCGGG + Exonic
1090831811 11:130425759-130425781 AAAATACAAAAAAAATAGCCAGG - Intronic
1091147992 11:133297397-133297419 AGAAAAGAAAACAAACAGCAGGG - Intronic
1091188426 11:133668330-133668352 AGAATACAAAACAATTAGCCTGG + Intergenic
1091569206 12:1669855-1669877 AAAATACAAAAAAAATAGCCTGG - Intergenic
1091960987 12:4694067-4694089 AGAATCAAAATCAAACAGCCAGG - Exonic
1092003985 12:5053644-5053666 AAAATACAAAACAATTAGCCCGG - Intergenic
1092141087 12:6183856-6183878 TGCATACAAAACACTTAGCCTGG - Intergenic
1092223691 12:6732464-6732486 AAAATACAAAAAAAATAGCCGGG + Intergenic
1092224577 12:6739308-6739330 AAAAAACAAAACAAAAAGCCGGG + Intergenic
1092353361 12:7774239-7774261 TAAATACAAAAAAATTAGCCGGG + Intergenic
1092476265 12:8821477-8821499 AAAATACAAAACAATTAGCCAGG + Intergenic
1092611113 12:10174219-10174241 AAAATACAAAACAATTAGCCGGG - Intronic
1092736726 12:11589685-11589707 AAAATACAAAAAAATCAGCCGGG + Intergenic
1092875628 12:12845044-12845066 TAAATACAAAAAAATTAGCCGGG - Intergenic
1092887292 12:12936142-12936164 AAAATACAAAAAAAATAGCCGGG - Intergenic
1093456816 12:19372924-19372946 AAAATACAAAAAAATCAGCCAGG - Intronic
1093506703 12:19875160-19875182 AAAATACAAAACAAATAACCAGG - Intergenic
1093583899 12:20814728-20814750 AAAATACAAAACAATTAGCCGGG + Intronic
1093656625 12:21702064-21702086 AAAATACAAAAAAATCAGCCAGG - Intronic
1093785149 12:23184270-23184292 TGGCTACAAAATAAACAGGCTGG - Intergenic
1094405061 12:30108510-30108532 AAAATACAAAAAAAATAGCCAGG + Intergenic
1094551671 12:31457872-31457894 AAAATACAAAAAAAATAGCCGGG - Intronic
1094568809 12:31624191-31624213 TAAATACAAAAAAATGAGCCAGG + Intergenic
1094604656 12:31939976-31939998 AAAATACAAAAAAAATAGCCAGG + Intergenic
1094610822 12:31994223-31994245 TCAAAAAAAAACAAACAGGCTGG - Intergenic
1094652068 12:32388425-32388447 TAAATACAAAAAAATTAGCCGGG + Intergenic
1094801342 12:34039216-34039238 AAAATACAAAAAAATCAGCCGGG + Intergenic
1094821430 12:34229040-34229062 AAAATACAAAATAATCAGCCTGG + Intergenic
1095093551 12:38130265-38130287 AAAATACAAAATAATCAGCCGGG - Intergenic
1096114414 12:49047004-49047026 TAAATACAAAAAAATTAGCCAGG - Intronic
1096126283 12:49122197-49122219 AAAATACAAAACAATTAGCCGGG + Intergenic
1096131936 12:49166327-49166349 AAAATACAAAAAAAATAGCCAGG + Intergenic
1096252678 12:50043147-50043169 AAAATACAAAACAATGAGCCGGG - Intergenic
1096289320 12:50327700-50327722 AAAGTACAAAAAAAACAGCCAGG - Intronic
1096315923 12:50565454-50565476 AAAATACAAAACAATTAGCCGGG - Intronic
1096417080 12:51423873-51423895 CAAATACAAAAAAATCAGCCGGG + Intronic
1096679884 12:53248650-53248672 AAAATACAAAAAAAATAGCCGGG - Intergenic
1096682041 12:53262336-53262358 AAAATACAAAAAAAATAGCCGGG - Intergenic
1096742628 12:53705125-53705147 AAAATACAAAAAAATCAGCCAGG + Intergenic
1096832607 12:54325977-54325999 AAAATACAAAAAAAATAGCCGGG - Intronic
1097071627 12:56359498-56359520 TGAAAACAAAACAAAAAACCTGG + Intronic
1097097239 12:56559344-56559366 AAAATACAAAAAAATCAGCCAGG - Intronic
1097120328 12:56726571-56726593 CAAAAACAAAACAAACAGGCTGG - Intronic
1097327021 12:58288663-58288685 AAAATACAAAACAATTAGCCGGG - Intergenic
1097615780 12:61881946-61881968 TGAATACAAAAAAAAAATCTTGG + Intronic
1097813950 12:64050880-64050902 AAAATACAAAACAATTAGCCGGG - Intronic
1097830314 12:64217638-64217660 AAAATACAAAACAATTAGCCAGG + Intronic
1097868453 12:64579509-64579531 AAAATACAAAAAAAATAGCCAGG - Intergenic
1097872761 12:64614856-64614878 AAAATACAAAAAAAAAAGCCAGG - Intronic
1097928978 12:65163559-65163581 AGAATACAAAAAAATTAGCCGGG + Intergenic
1098285896 12:68906648-68906670 AAAATACAAAACAATTAGCCAGG - Intronic
1098425034 12:70353616-70353638 TGAGTACAAAAAATACAGACAGG - Intronic
1098537431 12:71609256-71609278 TGAAAACAAAATAAAAAGCAAGG + Intergenic
1099091674 12:78318177-78318199 TACATACAACACAAACAGCATGG - Intergenic
1099278689 12:80613372-80613394 TGCATATAAAACAAACAAACTGG + Intronic
1099533372 12:83815895-83815917 AAAATACAAAAAAAATAGCCAGG + Intergenic
1100076089 12:90785594-90785616 AAAATACAAAAAAATCAGCCGGG + Intergenic
1100208005 12:92372201-92372223 TGGATACAAAACAGACATACTGG - Intergenic
1100246840 12:92766667-92766689 AAAATACAAAAAAAATAGCCAGG + Intronic
1100475206 12:94929189-94929211 AAAATACAAAACAATTAGCCAGG + Intronic
1100557527 12:95710841-95710863 TAAATACAAAAAAATTAGCCAGG + Intronic
1100997547 12:100318866-100318888 AGACTACAAAACTAACAGTCTGG - Intronic
1101111187 12:101487712-101487734 AAAATACAAAAAAATCAGCCGGG - Intergenic
1101438741 12:104686806-104686828 TAAATACAAAAAAATTAGCCAGG - Intronic
1101616580 12:106343815-106343837 AGAATACAAAAAAAATAGCTGGG - Intronic
1101667707 12:106834821-106834843 AAAATACAAAAAAATCAGCCAGG + Intronic
1101738838 12:107483990-107484012 TGGATTAAAAATAAACAGCCTGG - Intronic
1101787097 12:107893654-107893676 AAAATACAAAAAAAATAGCCGGG - Intergenic
1101791164 12:107929051-107929073 AAAATACAAAAAAATCAGCCAGG + Intergenic
1102102483 12:110291201-110291223 TCAAAACAAAAAAAAAAGCCGGG - Intronic
1102255552 12:111412727-111412749 TAAATACAAAAAAATTAGCCTGG - Intronic
1102300938 12:111770803-111770825 AGAATACAAAAAAATTAGCCAGG - Intronic
1102372781 12:112396193-112396215 AAAATACAAAAAAAATAGCCGGG + Intergenic
1102835199 12:116050776-116050798 AAAATACAAAAAAATCAGCCAGG + Intronic
1102885966 12:116522030-116522052 AAAATACAAAAAAAATAGCCAGG + Intergenic
1103077719 12:117998003-117998025 CAAATACAAAAAAATCAGCCAGG + Intergenic
1103078641 12:118005734-118005756 AAAATACAAAAAAAATAGCCAGG + Intergenic
1103110797 12:118276539-118276561 AAAATACAAAAAAAATAGCCAGG + Intronic
1103224951 12:119278960-119278982 TAAATACAAAAAAATTAGCCAGG + Intergenic
1103442986 12:120977470-120977492 AGAATACAAAAAAATTAGCCGGG + Intergenic
1103532885 12:121614658-121614680 TGAATACAAAAAAATCAGCTGGG + Intergenic
1103581980 12:121922265-121922287 AAAATACAAAAAAATCAGCCAGG - Intronic
1103655725 12:122468827-122468849 AAAATACAAAAAAAATAGCCGGG + Intergenic
1103675768 12:122654494-122654516 AAAATACAAAACAATTAGCCAGG + Intergenic
1103887390 12:124212989-124213011 AAAATACAAAAAAAATAGCCGGG - Intronic
1104110816 12:125702495-125702517 AAAATACAAAAAAAATAGCCAGG - Intergenic
1104886095 12:132109410-132109432 TAAATACAAAAAAATTAGCCGGG - Intronic
1105035929 12:132920985-132921007 TAAATACAAAAAAATTAGCCGGG - Intronic
1105312598 13:19226236-19226258 TAAATACAAAAAAATTAGCCGGG + Intergenic
1105390940 13:19977648-19977670 AGAATACAAAAAAATTAGCCAGG - Intronic
1105391756 13:19986027-19986049 AAAATACAAAAAAATCAGCCTGG + Intronic
1105472841 13:20707295-20707317 TCACTACAAAAAAAACAGCCAGG + Intronic
1105495663 13:20928813-20928835 TAAATACAAAAAAATTAGCCAGG - Intergenic
1105627249 13:22124896-22124918 TGAAAAAAAAAAAAATAGCCTGG + Intergenic
1105732868 13:23236515-23236537 AAAATACAAAAAAATCAGCCGGG + Intronic
1105787389 13:23762824-23762846 TGAATACACAACCAACAGCGGGG + Intronic
1105890440 13:24678928-24678950 AAAATACAAAACAATTAGCCGGG - Intergenic
1106064902 13:26336712-26336734 AAAATACAAAACAATTAGCCGGG - Intronic
1106166292 13:27249555-27249577 TAAAAACAAAAAAATCAGCCAGG + Intergenic
1106710248 13:32323311-32323333 AAAATACAAAAAAATCAGCCAGG - Intronic
1106774459 13:32995150-32995172 AAAATACAAAAAAAACAGTCAGG - Intergenic
1106943144 13:34799080-34799102 TGAATACAATAAAGACAGCCAGG - Intergenic
1107128456 13:36869666-36869688 TAAATACAAAAAAATTAGCCGGG + Intronic
1107187027 13:37535292-37535314 AAAATACAAAACAATTAGCCAGG - Intergenic
1107190131 13:37572436-37572458 TGAGCACAAAACATAAAGCCAGG + Intronic
1107444139 13:40455445-40455467 TAAAAACAAAACAGACAGCCAGG + Intergenic
1107600160 13:42004838-42004860 TAAATACAAAAAAATTAGCCGGG - Intergenic
1107898124 13:44986529-44986551 AAAATACAAAAAAATCAGCCGGG + Intronic
1107924830 13:45248632-45248654 AAAATACAAAAAAATCAGCCGGG - Intronic
1108187947 13:47907293-47907315 AAAATACAAAAAAAATAGCCAGG + Intergenic
1108361584 13:49672897-49672919 ATAATACAAAACAATTAGCCGGG + Intronic
1108401441 13:50047966-50047988 AAAATACAAAAAAAATAGCCAGG - Intergenic
1108410904 13:50145861-50145883 TGAAAAAAACAGAAACAGCCGGG - Intronic
1108666897 13:52641864-52641886 ATAATACAAAACAAAAAGTCAGG + Exonic
1109380071 13:61548273-61548295 TCAATACAAAAAAATTAGCCCGG - Intergenic
1109430614 13:62229576-62229598 AAAATACAAAACAATTAGCCAGG - Intergenic
1109573087 13:64217213-64217235 TGCAAACAAAACAAAAACCCTGG + Intergenic
1109573688 13:64225845-64225867 TAAAAAAAAAAAAAACAGCCAGG - Intergenic
1109692696 13:65913853-65913875 AAAATACAAAAAAAATAGCCAGG + Intergenic
1110288552 13:73777971-73777993 AGAATACAAAACAATCAGCTGGG + Intronic
1110595537 13:77317108-77317130 CAAATACAAAACAATTAGCCGGG - Intronic
1110670620 13:78172985-78173007 TAAATACAAAAAAATTAGCCAGG - Intergenic
1110825361 13:79965097-79965119 AAAATACAAAACAATTAGCCAGG + Intergenic
1110869938 13:80438998-80439020 AGAATACAAAAAAATTAGCCGGG + Intergenic
1110947618 13:81443008-81443030 TGAATACACAGCAATCAGCCTGG - Intergenic
1111128708 13:83946313-83946335 TAAATACAAAAAAATTAGCCAGG - Intergenic
1111256148 13:85671316-85671338 TAAACACAAAACCATCAGCCAGG - Intergenic
1111510435 13:89255032-89255054 AAAATACAAAAAAAATAGCCGGG + Intergenic
1111706348 13:91753781-91753803 TGCAAACCAAACAAAAAGCCTGG - Intronic
1111733220 13:92103015-92103037 TGAAGAAAGAAAAAACAGCCAGG - Intronic
1112019544 13:95359739-95359761 AAAATAAAAAAAAAACAGCCAGG - Intergenic
1112019727 13:95361199-95361221 ACAAAACAAAACAAAAAGCCCGG - Intergenic
1112343298 13:98570035-98570057 AAAATACAAAAAAAACAGCTGGG - Intronic
1112420979 13:99248540-99248562 AAAATACAAAAAAAATAGCCAGG - Intronic
1112539693 13:100296398-100296420 AAAATACAAAAAAATCAGCCAGG - Intronic
1112771261 13:102797579-102797601 ATAATAAAAAACAAATAGCCAGG + Intronic
1112925341 13:104667261-104667283 AAAATACAAAAAAAATAGCCAGG - Intergenic
1113018452 13:105855493-105855515 TGAAAATACAAAAAACAGCCAGG + Intergenic
1113213574 13:108011600-108011622 AAAATACAAAAAAAATAGCCAGG - Intergenic
1113277877 13:108753207-108753229 AGAATACAAAAAAATTAGCCGGG + Intronic
1113438349 13:110309828-110309850 AAAATACAAAAAAATCAGCCGGG + Intronic
1113491093 13:110692652-110692674 AAAATACAAAACAATTAGCCAGG + Intronic
1113832820 13:113310230-113310252 AAAATAAAAAACACACAGCCAGG + Intronic
1114056245 14:18969540-18969562 AAAATACAAAACAATTAGCCAGG - Intronic
1114106306 14:19432186-19432208 AAAATACAAAACAATTAGCCAGG + Intronic
1114148827 14:20010798-20010820 AAAATACAAAACAATTAGCCGGG + Intergenic
1114223261 14:20715862-20715884 AAAATACAAAAAAATCAGCCGGG - Intergenic
1114321367 14:21549624-21549646 AAAATACAAAAAAAATAGCCAGG - Intergenic
1114622062 14:24102065-24102087 AAAATACAAAAAAATCAGCCAGG + Intronic
1114661528 14:24348613-24348635 AAAATACAAAAAAATCAGCCAGG - Intergenic
1114869528 14:26639558-26639580 AAAATACAAAAAAAATAGCCAGG + Intergenic
1115074447 14:29369789-29369811 TTAACACAAAACAAACTGCAGGG + Intergenic
1115198476 14:30827776-30827798 AAAATACAAAAAAAATAGCCAGG + Intergenic
1115241436 14:31254189-31254211 TAAATACAAAACAATCAGCCAGG - Intergenic
1115432001 14:33329976-33329998 TAAATAAAAAACACACTGCCTGG + Intronic
1115497198 14:34017770-34017792 AAAATACAAAACAATTAGCCAGG - Intronic
1115560210 14:34576082-34576104 AAAATACAAAAAAAATAGCCGGG - Intronic
1115612253 14:35059958-35059980 ACAAAACAAAAAAAACAGCCAGG - Intronic
1115686843 14:35805125-35805147 GGAATACAAAAAAAAAAGGCGGG + Intronic
1116246141 14:42414771-42414793 AAAATACAAAAAAAATAGCCAGG - Intergenic
1116558591 14:46346623-46346645 AAAATACAAAAAAAATAGCCAGG + Intergenic
1116562041 14:46392077-46392099 TGGATACAAAACAAATAGCAAGG - Intergenic
1116832097 14:49731117-49731139 TAAATACAAAACAATTAGCCGGG + Intronic
1117071048 14:52056629-52056651 TAAATACAAAAAAAATAGTCAGG + Intronic
1117122942 14:52588303-52588325 TAAATAAAAAAAAAGCAGCCAGG - Intronic
1117361647 14:54980948-54980970 AAAATACAAAAAAATCAGCCAGG + Intronic
1117559061 14:56917464-56917486 TGAATGTAAAAAAAACAGTCTGG + Intergenic
1118193930 14:63607321-63607343 AAAATACAAAACAATTAGCCGGG - Intronic
1118211660 14:63771228-63771250 AAAATACAAAAAAAATAGCCGGG - Intergenic
1118241939 14:64068699-64068721 AAAATACAAAAAAAATAGCCAGG + Intronic
1118310249 14:64686873-64686895 AAAATACAAAACAATCAGCCGGG + Intergenic
1118491089 14:66260976-66260998 TGGATACAATACCAACAGCACGG - Intergenic
1118692820 14:68356272-68356294 TAAATACAAAAAAATTAGCCGGG + Intronic
1118723908 14:68613255-68613277 ATAATACAAAACAATTAGCCAGG + Intronic
1118866141 14:69705155-69705177 AAAATACAAAACAATTAGCCGGG + Intronic
1118953058 14:70452524-70452546 AAAATACAAAAAAATCAGCCAGG - Intronic
1118964403 14:70566819-70566841 AAAATACAAAACAATTAGCCAGG + Intergenic
1118997303 14:70848405-70848427 AAAATACAAAAAAAATAGCCGGG + Intergenic
1119072687 14:71603760-71603782 AAAATACAAAAAAATCAGCCAGG + Intronic
1119332570 14:73805928-73805950 AAAATACAAAAAAATCAGCCAGG + Intergenic
1119553857 14:75538604-75538626 TTAAAACAAAACAAACGGCCAGG + Intronic
1119715359 14:76855187-76855209 TGACTACAGACCAAACAGACTGG + Intronic
1119745777 14:77042972-77042994 TGATTAAAAAAAAAATAGCCGGG - Intergenic
1119838958 14:77776563-77776585 TGAAAACAACACTCACAGCCGGG + Intergenic
1120111876 14:80566850-80566872 TGAAGAAAAAAAAAACAGCGAGG + Intronic
1120168858 14:81228929-81228951 AAAATACAAAAAAAATAGCCAGG + Intergenic
1120359290 14:83476393-83476415 TGAAAATAAAAAAAATAGCCAGG + Intergenic
1120364029 14:83542095-83542117 AAAATACAAAAAAAATAGCCGGG + Intergenic
1120582477 14:86270115-86270137 TGAATATAAAAAAGACGGCCAGG - Intergenic
1120870600 14:89333599-89333621 AAAATACAAAACAATTAGCCAGG + Intronic
1120898395 14:89554947-89554969 AAAATACAAAAAAACCAGCCAGG - Intronic
1120921510 14:89760117-89760139 TGAATAGAAAACAACCAGGAGGG + Intergenic
1121142211 14:91553646-91553668 AAAATACAAAAAAAATAGCCAGG + Intergenic
1121171972 14:91862177-91862199 AAAATACAAAAAAATCAGCCAGG + Intronic
1121230533 14:92354309-92354331 AAAATACAAAAAAAATAGCCGGG - Intronic
1121352722 14:93186027-93186049 AAAATACAAAAAAAATAGCCGGG - Intronic
1121763372 14:96464387-96464409 AAAATACAAAAAAAATAGCCAGG + Intronic
1121856787 14:97277735-97277757 TGAGTGCTAAACATACAGCCAGG + Intergenic
1122135118 14:99628282-99628304 TGAAAACAACACCAACAGCCGGG + Intergenic
1122202617 14:100131748-100131770 TGAAGACAAAAAAGACAGGCAGG + Intronic
1122208081 14:100158248-100158270 AAAATACAAAAAAAATAGCCGGG + Intronic
1122401132 14:101468135-101468157 TAAATACAAAAAAATTAGCCAGG - Intergenic
1122505391 14:102228537-102228559 AAAATACAAAAAAATCAGCCGGG + Intronic
1122590729 14:102848753-102848775 TGACTACTGAACAATCAGCCTGG - Intronic
1122704557 14:103612095-103612117 TAAAAACAAAAAAAATAGCCAGG - Intronic
1122735155 14:103834749-103834771 AGAATACAAAAAAAATAGCCAGG - Intronic
1122866371 14:104606312-104606334 AAAATACAAAAAAATCAGCCGGG + Intergenic
1122941933 14:104985367-104985389 AAAATACAAAAAAATCAGCCGGG + Intergenic
1122962882 14:105106159-105106181 TTATCACAAAACAACCAGCCAGG + Intergenic
1123020712 14:105396659-105396681 AAAATACAAAAAAAATAGCCAGG - Exonic
1123141040 14:106078977-106078999 TGAATAAAAAGGAATCAGCCAGG + Intergenic
1123465817 15:20514724-20514746 AAAATACAAAACAATTAGCCGGG - Intergenic
1123568697 15:21579437-21579459 AGAAAAAAAAAAAAACAGCCAGG + Intergenic
1123652296 15:22486315-22486337 TAAATACAAAACAATTAGCCGGG + Intergenic
1123664418 15:22597300-22597322 AAAATACAAAAAAAATAGCCGGG + Intergenic
1123711888 15:22994246-22994268 AAAATACAAAACAATTAGCCAGG - Intronic
1123742719 15:23295172-23295194 AAAATACAAAACAATTAGCCGGG + Intergenic
1123760606 15:23429314-23429336 AAAATACAAAACAATTAGCCGGG - Intergenic
1123763301 15:23449297-23449319 AAAATACAAAACAATTAGCCGGG - Intergenic
1123784408 15:23654888-23654910 TAAATACAAAAAAATTAGCCGGG - Intergenic
1123830092 15:24127218-24127240 AAAATACAAAACAATTAGCCTGG - Intergenic
1123983836 15:25626714-25626736 TGAATACAATAAAAACAGATTGG + Intergenic
1124276540 15:28330698-28330720 AAAATACAAAACAATTAGCCGGG - Intergenic
1124306161 15:28580909-28580931 AAAATACAAAACAATTAGCCGGG + Intergenic
1124318253 15:28691737-28691759 AAAATACAAAAAAAATAGCCGGG + Intergenic
1124348440 15:28937815-28937837 AAAATACAAAACAATTAGCCGGG - Intronic
1124656172 15:31509437-31509459 AAAATACAAAAAAAATAGCCGGG - Intronic
1124927602 15:34086587-34086609 TAAATACAAAAAAATTAGCCGGG - Intronic
1124960123 15:34387589-34387611 AAAATACAAAAAAAAAAGCCGGG - Intronic
1124976752 15:34533810-34533832 AAAATACAAAAAAAAAAGCCGGG - Intronic
1125019439 15:34970048-34970070 ACAAAACAAAAAAAACAGCCTGG + Intergenic
1125023907 15:35011526-35011548 TAAATACAAAAAAAACAGACAGG + Intergenic
1125465894 15:39952129-39952151 TCAAAACAAAACAAACATCCTGG + Intronic
1125576448 15:40758916-40758938 AAAATACAAAACAATTAGCCGGG + Intergenic
1125607023 15:40945309-40945331 AAAATACAAAACAATTAGCCGGG + Intergenic
1125657473 15:41369905-41369927 AAAATACAAAACAATTAGCCAGG + Intronic
1125657518 15:41370219-41370241 AAAATACAAAAAAAATAGCCGGG + Intronic
1125830581 15:42714221-42714243 AGAATACAAAAAAATTAGCCGGG - Intronic
1125838264 15:42773274-42773296 TTAATACAAAAAAATTAGCCGGG + Intronic
1125883465 15:43211905-43211927 AAAATAAAAAAAAAACAGCCAGG + Intronic
1125912863 15:43457509-43457531 AAAATACAAAAAAATCAGCCAGG + Intronic
1125981729 15:44008422-44008444 AAAATACAAAAAAAATAGCCAGG - Intronic
1126597059 15:50393786-50393808 AAAATACAAAAAAATCAGCCAGG - Intergenic
1127356176 15:58202325-58202347 AAAATACAAAAAAAATAGCCAGG + Intronic
1127419105 15:58787574-58787596 AAAATACAAAACAATTAGCCAGG + Intronic
1127517723 15:59712731-59712753 TGAAAATACAACAATCAGCCAGG - Intergenic
1127591748 15:60432346-60432368 AAAATACAAAAAAATCAGCCTGG - Intronic
1127748809 15:62010027-62010049 AAAATACAAAAAAAATAGCCAGG + Intronic
1128035284 15:64519471-64519493 AGAATACAAAACCCACAGCTGGG + Intronic
1128141398 15:65303293-65303315 AAAATACAAAACAATTAGCCGGG - Intergenic
1128172155 15:65522443-65522465 TAAATACAAAAAAATTAGCCAGG + Intergenic
1128284343 15:66423911-66423933 TAAAAATAAAACAATCAGCCAGG - Intronic
1128947889 15:71842697-71842719 AAAATACAAAAAAATCAGCCGGG + Intronic
1129155708 15:73716183-73716205 AGAATACAAAAAAATTAGCCGGG + Intergenic
1129574922 15:76732982-76733004 TGGATACAAGACAAACGGGCAGG - Intronic
1129586689 15:76874801-76874823 AAAATAAAAAACAAATAGCCAGG + Intronic
1129595573 15:76961322-76961344 AAAAAACAAAACAAAAAGCCTGG + Intergenic
1129626079 15:77201396-77201418 AAAATACAAAAAAAATAGCCAGG - Intronic
1129808788 15:78489059-78489081 AAAATACAAAACAATTAGCCAGG + Intronic
1129810334 15:78505268-78505290 AGAATACAAAAAAATTAGCCGGG - Intergenic
1130006751 15:80107052-80107074 AAAATACAAAAAAATCAGCCAGG + Intronic
1130060347 15:80565081-80565103 AAAATACAAAAAAATCAGCCAGG - Intronic
1130189825 15:81723184-81723206 TTAATACAGAGCAAATAGCCAGG - Intergenic
1130267362 15:82419487-82419509 AAAATACAAAAAAAATAGCCGGG + Intergenic
1130434136 15:83880223-83880245 TAAATACATAACAAAGAGCTTGG - Intronic
1130791268 15:87158563-87158585 AAAATACAAAAAAATCAGCCTGG - Intergenic
1130933338 15:88448579-88448601 TGAATCCAAACCTGACAGCCTGG + Intergenic
1131016307 15:89060249-89060271 TAAATACAAAAAAATTAGCCGGG - Intergenic
1131490240 15:92856486-92856508 GAAATACAAAAAAAATAGCCGGG + Intergenic
1131496654 15:92917398-92917420 AAAATACAAAACAATTAGCCAGG + Intronic
1131498365 15:92935194-92935216 AAAATACAAAACAATTAGCCAGG - Intronic
1131521400 15:93118650-93118672 AAAATACAAAACAATTAGCCGGG - Intergenic
1131674995 15:94662604-94662626 AAAATACAAAACAATTAGCCGGG - Intergenic
1131878338 15:96834868-96834890 AAAATACAAAACAATTAGCCGGG - Intergenic
1131901548 15:97093434-97093456 AAAATACAAAAAAATCAGCCAGG - Intergenic
1131984600 15:98029338-98029360 TAAAAAAAAAAAAAACAGCCGGG - Intergenic
1132048582 15:98587572-98587594 AAAATACAAAACAATTAGCCAGG + Intergenic
1132136944 15:99350954-99350976 AAAATACAAAAAAATCAGCCAGG - Intronic
1132148900 15:99446031-99446053 AAAATACAAAAAAAATAGCCAGG - Intergenic
1132280082 15:100605306-100605328 TTAATACAAAGCTAACTGCCAGG - Intronic
1132343851 15:101095221-101095243 AAAATACAAAACAATTAGCCAGG - Intergenic
1132460628 16:52603-52625 AAAATACAAAAAAATCAGCCAGG + Intronic
1132526908 16:421389-421411 AAAATACAAAACAATTAGCCAGG + Intergenic
1132609671 16:809171-809193 AAAATACAAAACAAATTGCCAGG - Intronic
1133046955 16:3093365-3093387 AAAATACAAAACAATTAGCCAGG + Intronic
1133546967 16:6816903-6816925 AAAATACAAAAAAAACAGCTAGG - Intronic
1133552115 16:6866700-6866722 AAAATACAAAAAAATCAGCCAGG - Intronic
1133793368 16:9026779-9026801 AAAATACAAAAAAATCAGCCGGG - Intergenic
1133829227 16:9306288-9306310 TAAATACAAAACAATTATCCGGG - Intergenic
1133962138 16:10503763-10503785 AAAATCCAAAACACACAGCCAGG + Intergenic
1134011177 16:10854266-10854288 AAAATACAAAACAATGAGCCGGG + Intergenic
1134082021 16:11331549-11331571 AAAATACAAAAAAAATAGCCGGG - Intronic
1134152698 16:11817609-11817631 TAAATACAAAAAATACAGCCGGG + Intergenic
1134159636 16:11876581-11876603 AAAATACAAAACAATCAGCCAGG + Intronic
1134200414 16:12193307-12193329 TGAAAATAAAACAATTAGCCGGG + Intronic
1134358051 16:13502714-13502736 AAAATACAAAACAATTAGCCAGG + Intergenic
1134382466 16:13740641-13740663 TGGATACAAGACAAAGAGGCAGG - Intergenic
1134611588 16:15613499-15613521 TAAATACAAAAAAATTAGCCGGG + Intronic
1134611696 16:15614320-15614342 AAAATACAAAAAAAATAGCCGGG + Intronic
1134780159 16:16888140-16888162 CAAAAACAAAAAAAACAGCCGGG - Intergenic
1134857649 16:17533969-17533991 TGAACACAAAAGGAATAGCCTGG + Intergenic
1134872084 16:17661270-17661292 AAAATACAAAACAATTAGCCGGG + Intergenic
1134906052 16:17980803-17980825 TGTAGATAAAACAAACATCCTGG - Intergenic
1135010732 16:18875428-18875450 TAAATACAAAAAAATTAGCCAGG + Intronic
1135152895 16:20025204-20025226 CAAAAACAAAAAAAACAGCCGGG + Intergenic
1135300483 16:21322530-21322552 AAAATACAAAAAAAATAGCCAGG - Intergenic
1135317618 16:21463024-21463046 TAAATACAAAAAAATTAGCCAGG + Intergenic
1135370510 16:21894828-21894850 TAAATACAAAAAAATTAGCCAGG + Intergenic
1135381500 16:21999874-21999896 TGAAAACACAAAAATCAGCCAGG + Intronic
1135441275 16:22475875-22475897 TAAATACAAAAAAATTAGCCAGG - Intergenic
1135677844 16:24432383-24432405 TGAAGACAAAGGATACAGCCGGG + Intergenic
1135701242 16:24634267-24634289 AAAATACAAAACAGATAGCCAGG + Intergenic
1135701487 16:24636649-24636671 TAAAAATAAAACAAAGAGCCAGG - Intergenic
1135960377 16:26989994-26990016 TTAAAGCACAACAAACAGCCAGG - Intergenic
1135998883 16:27274688-27274710 AAAATACAAAAAAATCAGCCAGG + Intronic
1136134374 16:28245879-28245901 AAAATACAAAAAAATCAGCCAGG + Intergenic
1136161405 16:28421658-28421680 AAAATACAAAAAAATCAGCCAGG + Intergenic
1136201559 16:28693334-28693356 AAAATACAAAAAAATCAGCCAGG - Intronic
1136217904 16:28807525-28807547 AAAATACAAAAAAATCAGCCAGG - Intergenic
1136314399 16:29442740-29442762 TAAATACAAAAAAATTAGCCAGG + Intergenic
1136327838 16:29544505-29544527 TAAATACAAAAAAATTAGCCAGG + Intergenic
1136442526 16:30284509-30284531 TAAATACAAAAAAATTAGCCAGG + Intergenic
1136574598 16:31116070-31116092 AAAATACAAAACAATTAGCCGGG - Intronic
1136929907 16:34409632-34409654 AGATAACAAAACAAGCAGCCAGG + Intergenic
1136974667 16:35002173-35002195 AGATAACAAAACAAGCAGCCAGG - Intergenic
1137318845 16:47357452-47357474 AAAATACAAAACAATTAGCCGGG + Intronic
1137693510 16:50446104-50446126 TGGCTGCAAAACAGACAGCCTGG - Intergenic
1137865246 16:51888233-51888255 TGGGTACAGAAGAAACAGCCTGG + Intergenic
1138479239 16:57290877-57290899 CTAATACAAAACAATTAGCCGGG + Intergenic
1138484955 16:57334538-57334560 TAAAAACACAAAAAACAGCCGGG - Intergenic
1138670549 16:58610874-58610896 AAAATACAAAAAAATCAGCCGGG + Intronic
1138740857 16:59308206-59308228 TAAATACAAAAAAATGAGCCGGG + Intergenic
1138771303 16:59667254-59667276 AAAATACAAAACAATCAGCCGGG - Intergenic
1138835955 16:60434877-60434899 AAAATACAAAACAATTAGCCAGG - Intergenic
1139279265 16:65755790-65755812 AAAATACAAAAAAAATAGCCAGG + Intergenic
1139380545 16:66527869-66527891 AAAATACAAAAAAAATAGCCAGG + Intronic
1139414284 16:66794608-66794630 TGAATACAAAAAACACAATCAGG + Intronic
1139710123 16:68769836-68769858 AGAATACAAAAAAATTAGCCAGG - Intronic
1139780092 16:69344125-69344147 TAAAAACAAAACAAAAGGCCGGG - Intronic
1139803867 16:69547001-69547023 AAAATACAAAAAAATCAGCCGGG - Intergenic
1139889328 16:70238223-70238245 TAAATACAAAAAAATTAGCCAGG + Intergenic
1140111265 16:72007577-72007599 AAAATACAAAACAATGAGCCGGG + Intergenic
1140208212 16:72950528-72950550 TGACTACTACACCAACAGCCTGG - Exonic
1140450142 16:75064138-75064160 AAAATACAAAAAAAACAGCCAGG + Intronic
1140468205 16:75199017-75199039 AAAATACAAAACAATTAGCCGGG - Intergenic
1140473038 16:75225616-75225638 AAAATACAAAACAATTAGCCGGG - Intergenic
1140518643 16:75563491-75563513 TAAATACAAAACAATTAGCCAGG - Intergenic
1140625500 16:76789298-76789320 AAAATACAAAAAAATCAGCCAGG - Intergenic
1140741030 16:77941745-77941767 AAAATACAAAAAAATCAGCCAGG - Intronic
1140856667 16:78984036-78984058 AAAATACAAAAAAAATAGCCGGG - Intronic
1140961912 16:79922606-79922628 TAAATAGAAAACAAATAGCCAGG + Intergenic
1141103828 16:81216836-81216858 GAAATACAAAAAAATCAGCCAGG - Intergenic
1141111495 16:81274422-81274444 AAAATACAAAACAATAAGCCAGG - Intronic
1141185213 16:81782030-81782052 AAAATACAAAACAATTAGCCGGG - Intronic
1141192300 16:81833492-81833514 TGAAAAAAAAAAAAACAGGCAGG - Intronic
1141586318 16:85035818-85035840 AGAATACAAAAAAATTAGCCAGG + Intronic
1141632556 16:85296307-85296329 TTAAAACAAAACAAAGGGCCGGG + Intergenic
1141876153 16:86825966-86825988 TGATTAAAAAAAAAAAAGCCAGG - Intergenic
1142293834 16:89206527-89206549 CGAATACAAAAAAATTAGCCAGG - Intergenic
1142853795 17:2718679-2718701 TCTAAAAAAAACAAACAGCCGGG + Intergenic
1142886512 17:2915856-2915878 AAAATACAAAAAAATCAGCCAGG - Intronic
1142988907 17:3715994-3716016 AAAATACAAAACAATTAGCCAGG + Intronic
1143005767 17:3832468-3832490 AAAATACAAAACAATTAGCCAGG + Intronic
1143215847 17:5224293-5224315 AAAATACAAAAAAATCAGCCGGG - Intronic
1143259199 17:5585507-5585529 AAAATACAAAACAATTAGCCAGG - Intronic
1143472455 17:7184449-7184471 AAAATACAAAACAATTAGCCGGG + Intergenic
1143489479 17:7276979-7277001 AAAATACAAAACAATTAGCCAGG + Intergenic
1143546314 17:7598292-7598314 AAAATACAAAAAAATCAGCCGGG + Intronic
1143808044 17:9445994-9446016 AAAATACAAAAAAATCAGCCGGG - Intronic
1143837916 17:9707484-9707506 AAAATACAAAACAATTAGCCGGG + Intronic
1144101586 17:11946501-11946523 AAAATACAAAAAAAATAGCCAGG + Intronic
1144156974 17:12514047-12514069 AAAATACAAAACAATTAGCCGGG + Intergenic
1144211891 17:13022812-13022834 AAAATACAAAAAAAACAGCCGGG - Intergenic
1144249512 17:13401434-13401456 AAAATACAAAACAATTAGCCAGG + Intergenic
1144476522 17:15593787-15593809 TAAATACAAAAAAATTAGCCAGG - Intronic
1144561460 17:16323775-16323797 AAAATACAAAACAATTAGCCAGG - Intronic
1144562862 17:16336160-16336182 TGTTTAAAAAACAAATAGCCGGG + Intronic
1144567000 17:16368009-16368031 TAAAAACAAAAAAATCAGCCTGG - Intergenic
1144608153 17:16686075-16686097 AAAAAACAAAAAAAACAGCCGGG - Intergenic
1144903778 17:18623905-18623927 AAAATACAAAAAAAATAGCCGGG - Intergenic
1144921730 17:18769614-18769636 TAAATACAAAAAAATTAGCCAGG + Intronic
1144964675 17:19069192-19069214 AAAATACAAAACAATTAGCCAGG + Intergenic
1144983292 17:19182982-19183004 AAAATACAAAACAATTAGCCAGG - Intergenic
1144984933 17:19195257-19195279 AAAATACAAAACAATTAGCCAGG + Intergenic
1145050758 17:19658564-19658586 AAAATACAAAAAAATCAGCCGGG + Intronic
1145087528 17:19955059-19955081 AAAATACAAAAAAATCAGCCGGG + Intronic
1145090615 17:19982838-19982860 AAAATACAAAAAAATCAGCCGGG + Intergenic
1145225502 17:21124807-21124829 AAAATACAAAAAAATCAGCCAGG - Intronic
1145389791 17:22446702-22446724 TAAATATAAAACAAACTCCCAGG - Intergenic
1145952100 17:28826518-28826540 TAAACACAAAAAAAACAGCCAGG + Intronic
1146041554 17:29459440-29459462 ATAAAAAAAAACAAACAGCCGGG - Intronic
1146202551 17:30872470-30872492 AGAATACAGAAGAAACAGCTGGG - Intronic
1146265011 17:31446987-31447009 TTAATACAAAAAAGACAGGCGGG + Intronic
1146326325 17:31889124-31889146 AAAATACAAAAAAAATAGCCAGG + Intronic
1146505820 17:33404393-33404415 TAAATACAAGACTAAGAGCCAGG + Intronic
1146678808 17:34792401-34792423 AAAATACAAAAAAAATAGCCAGG + Intergenic
1146777652 17:35635847-35635869 TAAATACAAAAAAATTAGCCAGG - Intronic
1146798448 17:35799561-35799583 AAAATACAAAAAAAATAGCCAGG - Intronic
1146970963 17:37072086-37072108 TAAATACAAAAAAATTAGCCGGG - Intergenic
1147006824 17:37410005-37410027 AAAATACAAAACAATTAGCCAGG + Intronic
1147109583 17:38252074-38252096 AAAATACAAAAAAATCAGCCAGG + Intergenic
1147128165 17:38387284-38387306 AAAATACAAAAAAAATAGCCGGG + Intronic
1147174893 17:38649033-38649055 AAAATACAAAAAAATCAGCCGGG - Intergenic
1147222733 17:38948371-38948393 AAAATACAAAATAATCAGCCAGG - Intronic
1147272047 17:39280072-39280094 AAAATACAAAAAAATCAGCCAGG + Intronic
1147386064 17:40083085-40083107 AAAATACAAAAAAAATAGCCGGG - Intronic
1147399382 17:40170765-40170787 AGAAAACAAAACAAACAGGAAGG - Exonic
1147416998 17:40299306-40299328 AAAATACAAAAAAAACAGCCGGG - Intronic
1147629753 17:41922216-41922238 AAAATACAAAAAAAATAGCCGGG + Intronic
1147641675 17:42006102-42006124 AAAATACAAAAAAATCAGCCAGG - Intronic
1147744139 17:42684763-42684785 AAAATACAAAAAAATCAGCCGGG + Intronic
1147849466 17:43430662-43430684 TAAAAACAAAACAAACTGCCGGG - Intergenic
1147955308 17:44130318-44130340 AAAATACAAAAAAAATAGCCGGG + Intergenic
1148069289 17:44898376-44898398 AGAATACAAAAAAATTAGCCAGG - Intronic
1148093721 17:45038235-45038257 AAAATACAAAAAAATCAGCCAGG - Intronic
1148120971 17:45210982-45211004 AAAATACAAAACAATTAGCCGGG - Intergenic
1148141123 17:45329560-45329582 TGAAAGCAAAACAAAGCGCCCGG - Intergenic
1148148491 17:45381331-45381353 AAAATACAAAAAAAATAGCCAGG - Intergenic
1148151739 17:45400752-45400774 TAAATACAAAAAAATTAGCCGGG + Intronic
1148391728 17:47277426-47277448 TAAATACAGAACATCCAGCCTGG + Intronic
1148401173 17:47362869-47362891 TGGATACAAAACAAAGGGGCAGG - Intronic
1148419869 17:47535995-47536017 AAAATACAAAAAAATCAGCCAGG - Intronic
1148483739 17:47977307-47977329 AAAATACAAAACAATTAGCCGGG - Intronic
1148653012 17:49263067-49263089 TGAAAACACAAAAATCAGCCAGG + Intergenic
1149375785 17:56042631-56042653 TAAATACAAAAAAATTAGCCAGG - Intergenic
1149413771 17:56436667-56436689 TAAATACAAAAAAATTAGCCAGG + Intronic
1149476318 17:56963956-56963978 AGAACAAAAAACAAACAGGCTGG - Intergenic
1149480136 17:56996678-56996700 TGAAAACACAAAAATCAGCCGGG - Intronic
1149536722 17:57438958-57438980 AAAATGCAAAACAAATAGCCGGG - Intronic
1149553788 17:57558900-57558922 AAAATACAAAAAAAACAGCGAGG + Intronic
1149586415 17:57790603-57790625 TGAAAAAAAGATAAACAGCCAGG - Intergenic
1149733615 17:58971490-58971512 TGCATAAAGAACTAACAGCCTGG - Intronic
1150057291 17:62030015-62030037 TGAAAACAAAACAAAAAAACAGG + Intronic
1150077445 17:62204613-62204635 TAAATACAAAAAAATCAGCTGGG - Intergenic
1150128782 17:62655123-62655145 TAAATACAAAAAAATTAGCCGGG + Intronic
1150230629 17:63548103-63548125 AAAATACAAAAAAAATAGCCAGG + Intronic
1150412722 17:64960379-64960401 TGAAAACATAATTAACAGCCTGG - Intergenic
1150474046 17:65460796-65460818 AAAATACAAAACAATTAGCCGGG + Intergenic
1150539639 17:66083688-66083710 TAAATACAAAAAAATTAGCCAGG + Intronic
1150555726 17:66252521-66252543 AGAATACAAAAAAATTAGCCGGG + Intronic
1150633177 17:66894581-66894603 TGAATAAAAAATCAAGAGCCAGG - Intergenic
1150735063 17:67729737-67729759 AAAATACAAAAAAATCAGCCAGG - Intronic
1150786142 17:68164299-68164321 ACAAAACAAAACAAAAAGCCAGG + Intergenic
1150796763 17:68244770-68244792 TTATTTCAAAACAAACAGCTTGG + Intergenic
1151214942 17:72571011-72571033 AAAATACAAAAAAATCAGCCGGG + Intergenic
1151268500 17:72975276-72975298 TAAATACAAAAAAATTAGCCAGG + Intronic
1151324210 17:73368849-73368871 GAAATACAAAAAAATCAGCCGGG + Intronic
1151438276 17:74111985-74112007 AAAATACAAAAAAATCAGCCAGG + Intergenic
1151609758 17:75164966-75164988 CAAATACAAAAAAATCAGCCAGG + Intronic
1151634906 17:75339785-75339807 AAAATACAAAACAATTAGCCAGG - Intronic
1151643692 17:75415022-75415044 AAAATACAAAAAAATCAGCCAGG + Intergenic
1151736844 17:75947875-75947897 AAAATACAAAAAAAGCAGCCAGG - Intronic
1151925451 17:77192658-77192680 TGAAGAAAAAAAAAAAAGCCTGG - Intronic
1152171413 17:78751892-78751914 AAAATACAAAACAATTAGCCGGG - Intronic
1152346086 17:79752759-79752781 AAAATACAAAAAAATCAGCCGGG - Intergenic
1152385752 17:79973547-79973569 AAAATACAAAAAAAATAGCCAGG + Intronic
1152548483 17:81016106-81016128 AAAATACAAAAAAAATAGCCGGG + Intergenic
1152731313 17:81972406-81972428 TGAAAACACAAAAAATAGCCGGG - Intergenic
1152752308 17:82068739-82068761 AAAATACAAAACAATTAGCCAGG + Intergenic
1152934855 17:83130391-83130413 AAAATACAAAAAAAATAGCCGGG - Intergenic
1152972178 18:173266-173288 AAAATACAAAAAAAATAGCCGGG - Intronic
1153257866 18:3190705-3190727 TGAATACAAAACAAACCATCAGG + Intronic
1153277168 18:3378715-3378737 ACAATACAAAAAAATCAGCCGGG + Intergenic
1153306354 18:3635289-3635311 ACAATACAAAAAAATCAGCCGGG - Intronic
1153423570 18:4937152-4937174 AAAATACAAAAAAATCAGCCAGG + Intergenic
1153424588 18:4947755-4947777 AAAATACAAAACAATTAGCCAGG + Intergenic
1153554737 18:6299828-6299850 CAAATACAAAAAAAATAGCCGGG - Intronic
1153773170 18:8431604-8431626 AAAATACAAAACAATTAGCCGGG + Intergenic
1153787303 18:8546218-8546240 TAAATACAAAAAAATTAGCCGGG + Intergenic
1153891837 18:9524082-9524104 AAAATACAAAAAAATCAGCCAGG + Intronic
1154010652 18:10571445-10571467 AGAATACAAAATTAACGGCCAGG - Intergenic
1154044748 18:10894291-10894313 AAAATACAAAAAAAACAGCCAGG + Intronic
1154059242 18:11043828-11043850 AAAATACAAAAAAATCAGCCAGG - Intronic
1154151856 18:11912535-11912557 AGAATACAAAAAAATTAGCCAGG + Intergenic
1154206287 18:12339686-12339708 AAAATACAAAAAAATCAGCCAGG + Intronic
1154222945 18:12472951-12472973 AAAATACAAAAAAAATAGCCAGG - Intronic
1155047157 18:22112966-22112988 TGAATATACAAAAATCAGCCTGG - Intergenic
1155167789 18:23245348-23245370 AAAATACAAAAAAAATAGCCAGG + Intronic
1155290142 18:24332215-24332237 AAAATACAAAAAAATCAGCCAGG + Intronic
1155306891 18:24487422-24487444 TCAAAACAAAACAAATCGCCTGG + Intergenic
1155471385 18:26195835-26195857 AAAATACAAAAAAATCAGCCAGG + Intergenic
1155567065 18:27147223-27147245 AAAATACAAAAAAATCAGCCGGG - Intronic
1155798691 18:30073399-30073421 AAAATACAAAAAAAATAGCCAGG + Intergenic
1155930133 18:31698469-31698491 AAAATACAAAACAATTAGCCAGG + Intergenic
1156138623 18:34077145-34077167 AAAATACAAAACAAATAGCTGGG + Intronic
1156200384 18:34824313-34824335 AAAATACAAAAAAAATAGCCGGG + Intronic
1156203362 18:34858769-34858791 TAAATACAAAAAAATTAGCCAGG - Intronic
1156330294 18:36115279-36115301 AAAATACAAAAAAAATAGCCAGG + Intronic
1156524319 18:37752252-37752274 TGAACACAAAATAAACACACAGG - Intergenic
1156671356 18:39473821-39473843 AAAATACAAAAAAAATAGCCGGG + Intergenic
1157254945 18:46130560-46130582 AAAATACAAAAAAAATAGCCAGG + Intergenic
1157364254 18:47048993-47049015 AAAATACAAAACAATTAGCCGGG - Intronic
1157863449 18:51161512-51161534 AAAATACAAAAAAATCAGCCGGG - Intergenic
1157900309 18:51508752-51508774 AAAATACAAAAAAAATAGCCAGG + Intergenic
1157971212 18:52271231-52271253 TCACTAGAAAACACACAGCCAGG + Intergenic
1158139241 18:54240206-54240228 AAAATACAAAACAATTAGCCGGG - Intergenic
1158274846 18:55756253-55756275 AAAATACAAAAAAAATAGCCGGG - Intergenic
1158309807 18:56145526-56145548 AAAATACAAAAAAAATAGCCAGG - Intergenic
1158386154 18:56994178-56994200 AGAATACAAAAAAATTAGCCAGG - Intronic
1158603627 18:58876091-58876113 AAAATACAAAAAAAATAGCCGGG - Intronic
1158802638 18:60930710-60930732 TGAACAAAAAACATCCAGCCAGG - Intergenic
1159016052 18:63102403-63102425 AAAATACAAAAAAATCAGCCGGG + Intergenic
1159090010 18:63837379-63837401 TGTGTACAAAATACACAGCCAGG + Intergenic
1159178101 18:64865364-64865386 AGAATACAAAATAATTAGCCAGG - Intergenic
1159339328 18:67114787-67114809 ACAAAACAAAACAAAAAGCCTGG - Intergenic
1159790805 18:72777255-72777277 TAAATACAAAAAAATTAGCCTGG + Intronic
1159835915 18:73335247-73335269 AAAATACAAAACAATTAGCCGGG + Intergenic
1160115609 18:76076394-76076416 TGAATTCCAAACAAGCAGCTTGG + Intergenic
1160170811 18:76552577-76552599 TGTATCCAAAACATATAGCCGGG + Intergenic
1160223921 18:76997840-76997862 AAAATACAAAAAAATCAGCCGGG - Intronic
1160333185 18:78014125-78014147 AAAATACAAAAAAATCAGCCGGG + Intergenic
1160440423 18:78885480-78885502 AGAAGAAAAAGCAAACAGCCTGG + Intergenic
1160624762 18:80195712-80195734 AAAATACAAAAAAATCAGCCAGG + Intronic
1160688084 19:446598-446620 TTAAAACAACACAGACAGCCGGG - Intronic
1160813213 19:1022363-1022385 AAAATACAAAAAAAATAGCCGGG - Intergenic
1160890545 19:1376284-1376306 AAAAAAAAAAACAAACAGCCGGG - Intronic
1160908477 19:1463255-1463277 CAAATACAAAAAAAATAGCCAGG + Intronic
1161042937 19:2119773-2119795 AGAATACAAAAAAATTAGCCAGG + Intronic
1161172917 19:2822209-2822231 AAAATACAAAAAAAATAGCCAGG - Intronic
1161179738 19:2871850-2871872 TGGATACAAGACAAACGGGCAGG + Intronic
1161244033 19:3239258-3239280 TAAAAAAAAAACAAACAGCTGGG - Intronic
1161279400 19:3437205-3437227 AAAATACAAAAAAAATAGCCGGG + Intronic
1161603693 19:5202243-5202265 TAAATACAAAAAAAATAGCCGGG + Intronic
1161657058 19:5522828-5522850 AAAATACAAAAAAAACAGCCAGG + Intergenic
1161692830 19:5747001-5747023 AAAATACAAAAAAATCAGCCAGG - Intronic
1161737047 19:5997692-5997714 TAAAAACAAGACAAAAAGCCAGG + Intronic
1161780702 19:6289965-6289987 AAAATACAAAAAAAATAGCCAGG + Intergenic
1161805891 19:6442707-6442729 TAAATACAAAAAAATTAGCCGGG - Intronic
1161813763 19:6486432-6486454 AAAATACAAAAAAATCAGCCAGG - Intergenic
1161837746 19:6659497-6659519 AAAATACAAAACAATTAGCCGGG - Intergenic
1161895903 19:7080141-7080163 AAAATACAAAAAAATCAGCCAGG + Intronic
1161925884 19:7299279-7299301 AAAATACAAAAAAAATAGCCAGG + Intergenic
1162080987 19:8217695-8217717 AAAATACAAAAAAAATAGCCAGG - Intronic
1162098155 19:8323026-8323048 TGGATACAAACCAGGCAGCCTGG - Exonic
1162112834 19:8409893-8409915 AAAATACAAAAAAATCAGCCGGG + Intronic
1162181958 19:8876081-8876103 AAAATACAAAACAATTAGCCAGG + Intronic
1162329540 19:10019135-10019157 AAAATACAAAACAATCAGCCAGG + Intronic
1162363363 19:10232600-10232622 AAAATACAAAAAAATCAGCCAGG - Intergenic
1162428227 19:10610490-10610512 AAAATACAAAAAAATCAGCCGGG - Intronic
1162579926 19:11522908-11522930 AAAATACAAAAAAAATAGCCAGG + Intronic
1162606967 19:11716617-11716639 AAAATACAAAAAAAATAGCCGGG - Intergenic
1162660974 19:12168834-12168856 TAAATACAAAAAAATTAGCCGGG - Intronic
1162718801 19:12649640-12649662 AAAATACAAAAAAATCAGCCGGG - Intronic
1162871885 19:13592580-13592602 AAAATACAAAAAAATCAGCCGGG - Intronic
1162894287 19:13755795-13755817 CAAATACAAAAAAAATAGCCGGG + Intronic
1162912756 19:13858182-13858204 AAAATACAAAAAAAATAGCCAGG - Intergenic
1162913224 19:13861188-13861210 AAAATACAAAAAAATCAGCCAGG + Intergenic
1163004120 19:14386852-14386874 AAAATACAAAAAAATCAGCCGGG + Intronic
1163123140 19:15230327-15230349 AAAATACAAAAAAATCAGCCAGG - Intronic
1163136559 19:15315693-15315715 AAAATACAAAAAAACCAGCCGGG + Intronic
1163234829 19:16024112-16024134 AAAATACAAAACAATTAGCCGGG + Intergenic
1163394838 19:17053821-17053843 AAAATACAAAAAAAATAGCCAGG - Intronic
1163400244 19:17087767-17087789 TAAATACAAAAAAATTAGCCAGG + Intronic
1163413933 19:17174188-17174210 AAAATACAAAACAATTAGCCAGG - Intronic
1163457502 19:17416574-17416596 AAAATACAAAACAATTAGCCAGG - Intronic
1163713807 19:18862669-18862691 TAAATACAAAAAAATGAGCCGGG + Intronic
1163735283 19:18976354-18976376 TAAATACACAAAAATCAGCCGGG + Intergenic
1163743261 19:19029780-19029802 TAAATACAAAAAAATTAGCCGGG + Intronic
1163993847 19:21024617-21024639 AAAATACAAAAAAATCAGCCGGG + Intronic
1164139551 19:22446393-22446415 AAAATACAAAACAATTAGCCGGG - Intronic
1164485693 19:28653925-28653947 AGAATACAAAAAAATCAGCTGGG + Intergenic
1164786308 19:30933920-30933942 TGAATCCAAGACACAGAGCCAGG + Intergenic
1165044685 19:33095420-33095442 AAAATACAAAAAAAATAGCCAGG - Intronic
1165398335 19:35580444-35580466 AAAATACAAAAAAATCAGCCAGG + Intergenic
1165402114 19:35608088-35608110 AAAATACAAAAAAATCAGCCGGG - Intergenic
1165551621 19:36591558-36591580 GAAATACAAAAAAATCAGCCGGG + Intronic
1165570821 19:36773212-36773234 TGAGTTCCAAACTAACAGCCAGG - Exonic
1165748460 19:38245329-38245351 AAAATACAAAACAATTAGCCGGG - Intronic
1165948940 19:39462066-39462088 AAAATACAAAAAAATCAGCCGGG - Intronic
1165954569 19:39494100-39494122 TCAAAACAAAACAAAAAGCCAGG - Intergenic
1166090372 19:40504506-40504528 AAAATACAAAACAATTAGCCGGG + Intronic
1166199540 19:41227644-41227666 AAAATACAAAAAAATCAGCCGGG - Intronic
1166309471 19:41954663-41954685 AAAATACAAAAAAATCAGCCGGG + Intergenic
1166323150 19:42031949-42031971 AAAATACAAAACAATTAGCCAGG + Intronic
1166413898 19:42577838-42577860 AAAATACAAAAAAAATAGCCGGG - Intergenic
1166661611 19:44650858-44650880 ACAAAACAAAACAAAAAGCCGGG - Intronic
1166725289 19:45023596-45023618 AAAATACAAAAAAAATAGCCGGG - Intronic
1166761446 19:45226911-45226933 AGAATACAAAAAAATTAGCCGGG - Intronic
1167030739 19:46958221-46958243 AAAATACAAAACAATTAGCCGGG + Intronic
1167050217 19:47073409-47073431 AAAATACAAAAAAAATAGCCGGG + Intronic
1167106621 19:47433800-47433822 AAAATACAAAAAAATCAGCCAGG - Intronic
1167165399 19:47796111-47796133 AAAATACAAAAAAATCAGCCGGG - Intergenic
1167212899 19:48144660-48144682 AAAATACAAAAAAATCAGCCAGG - Intronic
1167370421 19:49077758-49077780 ACAAAACAAAACAAAAAGCCAGG + Intergenic
1167573059 19:50302284-50302306 TAAAAAAAAAAAAAACAGCCAGG + Intronic
1167585645 19:50373864-50373886 AAAATACAAAAAAAATAGCCAGG - Intronic
1167589038 19:50392771-50392793 TCATTAAGAAACAAACAGCCTGG - Intronic
1167861900 19:52291596-52291618 TAAATACAAAAAAATTAGCCAGG + Exonic
1167894006 19:52566324-52566346 TAAATACAAAAGAATTAGCCGGG - Intronic
1167911683 19:52708674-52708696 AGAATACAAAAAAATCAGCTGGG + Intronic
1167919396 19:52770279-52770301 AGAATACAAAAAAAACAGCTGGG + Intronic
1167931678 19:52870984-52871006 AGAATACAAAAAAATTAGCCAGG + Intronic
1167940693 19:52943539-52943561 AAAATACAAAACAATTAGCCAGG - Intronic
1168003189 19:53465437-53465459 AAAATACAAAACAAAAGGCCAGG + Intergenic
1168046492 19:53797897-53797919 TAAATACAAAAAAAATAGCCGGG - Intronic
1168135834 19:54350912-54350934 AGAATACAAAAAAATTAGCCGGG - Intergenic
1168234412 19:55052955-55052977 AAAATACAAAACAATCAGGCAGG - Intronic
1168506092 19:56936315-56936337 TAAATATACAACAACCAGCCAGG + Intergenic
1168550226 19:57286801-57286823 AAAATACAAAACAATTAGCCAGG + Intronic
1168692298 19:58384565-58384587 AAAATACAAAAAAAATAGCCGGG + Intergenic
1168711752 19:58504843-58504865 AAAATACAAAAAAAATAGCCAGG + Intronic
1202664508 1_KI270708v1_random:105478-105500 AAAATACAAAAAAAATAGCCAGG + Intergenic
925068275 2:947083-947105 AAAATACAAAAAAATCAGCCTGG + Intergenic
925207273 2:2017545-2017567 AAAATACACAACATACAGCCAGG + Intronic
925891885 2:8440929-8440951 AAAATACAAAAAAAAAAGCCAGG + Intergenic
926094366 2:10071539-10071561 TGAAAACAACAGAAACAGCAAGG - Intronic
926228571 2:10985757-10985779 AAAATACAAAAAAATCAGCCAGG + Intergenic
926296976 2:11576144-11576166 AAAATACAAAACAATCAGCTAGG + Intronic
926378730 2:12262547-12262569 TGAATACATAACATGCAACCAGG + Intergenic
926443011 2:12909871-12909893 AAAATACAAAAAAAATAGCCGGG - Intergenic
926498536 2:13621955-13621977 TAAATACAAAAAAATTAGCCAGG + Intergenic
926899122 2:17730161-17730183 CATCTACAAAACAAACAGCCTGG + Intronic
927106310 2:19830350-19830372 AAAATACAAAAAAATCAGCCAGG + Intergenic
927106425 2:19831387-19831409 AAAATACAAAAAAATCAGCCTGG + Intergenic
927218517 2:20684534-20684556 TATATTCAAAACAAACAGGCTGG - Intronic
927229544 2:20808501-20808523 AGAATACAAAAAAATTAGCCGGG + Intronic
927535657 2:23856026-23856048 AAAATACAAAAAAAATAGCCAGG + Intronic
927538974 2:23890052-23890074 AAAATACAAAAAAATCAGCCAGG + Intronic
927596500 2:24402618-24402640 TGCCTACAAAATAAACATCCTGG + Intergenic
927649747 2:24905292-24905314 AAAATACAAAAAAATCAGCCGGG - Intronic
927670082 2:25061652-25061674 AAAATACAAAAGAAATAGCCGGG - Intronic
927756183 2:25709941-25709963 AAAATACAAAACAATTAGCCGGG + Intergenic
927773350 2:25882834-25882856 AAAATACAAAACAACTAGCCAGG - Intergenic
927788026 2:25987528-25987550 AAAATACAAAAAAATCAGCCAGG + Intergenic
928338566 2:30421357-30421379 TGAATACCAAACTCAGAGCCAGG - Intergenic
928407691 2:31027269-31027291 TAAATACAAAAAAATTAGCCGGG + Intronic
928539345 2:32269695-32269717 AAAATACAAAACAATTAGCCAGG + Intergenic
928559998 2:32472225-32472247 AAAATACAAAACAATTAGCCGGG - Intronic
928657097 2:33463758-33463780 AAAATACAAAAAAAATAGCCAGG - Intronic
928695540 2:33846127-33846149 AAAATACAAAACAATTAGCCAGG - Intergenic
928710832 2:34003509-34003531 TGGAAACAAGAGAAACAGCCAGG - Intergenic
928905486 2:36363037-36363059 AGAATACAAAAAAATTAGCCAGG + Intronic
928967347 2:36990060-36990082 AAAATACAAAAAAAATAGCCAGG - Intronic
928971476 2:37034299-37034321 TAAAAACAAAACAAACAGCCAGG - Intronic
929207141 2:39309716-39309738 AAAATACAAAAAAATCAGCCGGG - Intronic
929356384 2:41029601-41029623 AAAATACAAAAAAAATAGCCGGG + Intergenic
929476685 2:42257674-42257696 AAAATACAAAAAAAATAGCCAGG + Intronic
929512126 2:42572886-42572908 TAAACACACAAAAAACAGCCAGG - Intronic
929668000 2:43848713-43848735 AAAATACAAAGAAAACAGCCAGG + Intronic
929697895 2:44134889-44134911 ACAAAACAAAACAAACAGACAGG + Intergenic
929878607 2:45817531-45817553 AAAATACAAAAAAATCAGCCGGG + Intronic
929915879 2:46135074-46135096 TGAAGCCAAAATAAATAGCCTGG - Intronic
930056549 2:47256797-47256819 TGATAACAAAACAAACTGCAAGG + Intergenic
930204918 2:48578133-48578155 TAAATACAAAAAAATTAGCCAGG - Intronic
930370231 2:50492244-50492266 GGAATAGAACACAAACAGCTGGG + Intronic
931142174 2:59473409-59473431 TGAATATACAAAAAACAGACTGG + Intergenic
931302388 2:60993294-60993316 AGAATACAAAAAAATTAGCCAGG + Intronic
931350996 2:61488939-61488961 AAAATACAAAAAAAATAGCCAGG + Intronic
931841750 2:66158471-66158493 AAAATACAAAAAAATCAGCCAGG - Intergenic
931909902 2:66887963-66887985 TGAATACAAAAAAATTAGCCAGG + Intergenic
932079156 2:68695601-68695623 TATATAAAAAACAAATAGCCTGG - Intronic
932179449 2:69632736-69632758 AAAATACAAAAAAAAAAGCCGGG + Intronic
932242582 2:70168871-70168893 AAAATACAAAACAATTAGCCAGG - Intronic
932405311 2:71509011-71509033 AAAATACAAAAAAAATAGCCAGG - Intronic
932684690 2:73858141-73858163 AAAATACAAAACAATTAGCCAGG - Intronic
932738035 2:74269364-74269386 CAAACAAAAAACAAACAGCCGGG - Intronic
932762524 2:74448195-74448217 AAAATACAAAAAAAATAGCCAGG + Intergenic
933105019 2:78313672-78313694 AAAATACAAAACAATTAGCCAGG + Intergenic
933146669 2:78862213-78862235 AGAATACAAAAAAATTAGCCGGG + Intergenic
933794330 2:85907554-85907576 AAAATACAAAAAAAATAGCCAGG - Intergenic
933959609 2:87399595-87399617 AAAATAAAAAAAAAACAGCCTGG + Intergenic
934530904 2:95087982-95088004 GCACTACAAAACAAACAACCTGG + Intronic
934741366 2:96725601-96725623 AAAATACAAAAAAATCAGCCGGG - Intronic
934749902 2:96787142-96787164 TTAATACAAAGGAAACACCCAGG - Intronic
935161788 2:100535617-100535639 TAAATACAAAACAATTAGCCGGG + Intergenic
935667217 2:105523185-105523207 AAAATACAAAAAAATCAGCCAGG + Intergenic
935694946 2:105763035-105763057 AGAATACAAAAGAATTAGCCAGG + Intronic
935993773 2:108746372-108746394 TAAAAAAAAAACAAAGAGCCAGG - Intronic
936021961 2:109001888-109001910 AAAATACAAAAAAAAAAGCCAGG - Intergenic
936435246 2:112499152-112499174 AGAATACAAAAAAATTAGCCAGG + Intronic
936652800 2:114448972-114448994 TGAATTTAAAACAAAAAGCAAGG - Intronic
936737381 2:115462888-115462910 AAAATACAAAACAATTAGCCGGG - Intronic
936798019 2:116230724-116230746 AAAATACAAAACAATTAGCCAGG - Intergenic
936830485 2:116639371-116639393 TAAATACAAAAAAATTAGCCGGG + Intergenic
936876808 2:117200096-117200118 AAAATACAAAAAAATCAGCCAGG - Intergenic
936969495 2:118163745-118163767 AAAATACAAAAAAAATAGCCGGG - Intergenic
937035511 2:118778347-118778369 AAAATACAAAAAAATCAGCCCGG - Intergenic
937196230 2:120159260-120159282 TAAAAAAAAAAAAAACAGCCGGG + Intronic
937215774 2:120312567-120312589 AAAATACAAAAAAATCAGCCGGG - Intergenic
937393790 2:121516866-121516888 TAAATACAAAAAAATTAGCCGGG + Intronic
937426401 2:121802862-121802884 TAAATACAAAAAAATTAGCCAGG - Intergenic
937880034 2:126858008-126858030 TGAAATCAAAGCACACAGCCTGG + Intergenic
937952590 2:127400370-127400392 TGAAGGCAAAACATATAGCCAGG + Intergenic
938186216 2:129234318-129234340 GGAAAACAAAACAGAGAGCCAGG - Intergenic
938336702 2:130507102-130507124 AAAATACAAAACAATTAGCCAGG + Intronic
938353120 2:130613559-130613581 AAAATACAAAACAATTAGCCAGG - Intronic
938474370 2:131593558-131593580 AAAATACAAAACAATTAGCCAGG - Intergenic
938600560 2:132834503-132834525 AAAATACAAAAAAAATAGCCAGG - Intronic
938670716 2:133583912-133583934 AAAATACAAAACAATTAGCCAGG - Intergenic
938754149 2:134364337-134364359 TAAATACAAAACAATTAGCTAGG + Intronic
938992041 2:136639726-136639748 TAAATACAAAAAAATTAGCCAGG - Intergenic
939253907 2:139718433-139718455 TCAAAACAAAACAAACAGGCCGG + Intergenic
939482203 2:142762985-142763007 AGAGGACAAAACACACAGCCTGG + Intergenic
939932414 2:148252297-148252319 AAAATACAAAAAAAATAGCCAGG + Intronic
940055903 2:149512272-149512294 AAAATACAAAAAAAATAGCCAGG + Intergenic
940079136 2:149780061-149780083 ACAAAACAAAAAAAACAGCCAGG - Intergenic
940212098 2:151265265-151265287 AAAATACAAAAAAATCAGCCGGG + Intergenic
940280380 2:151982471-151982493 AAAATACAAAAAAATCAGCCAGG + Intronic
940394096 2:153167378-153167400 TCAACACAAATCAGACAGCCTGG - Intergenic
940419244 2:153459319-153459341 TGATTACAAAAGAATCTGCCAGG + Intergenic
940651828 2:156448266-156448288 AAAATACAAAACAATTAGCCGGG - Intronic
940714552 2:157205314-157205336 AAAATACAAAACAATTAGCCGGG - Intergenic
940784155 2:157964288-157964310 TAAATACAAAAAAATGAGCCAGG - Intronic
940843412 2:158612016-158612038 TTAAAAAAAAAAAAACAGCCTGG + Intronic
940846227 2:158644859-158644881 AAAATATAAAACAAACACCCAGG - Intronic
940908889 2:159192943-159192965 TAAAAACTAAACAAATAGCCAGG - Intronic
940943872 2:159594244-159594266 AAAATACAAAAAAATCAGCCAGG + Intronic
941470116 2:165874048-165874070 AGAATACAACAAAAACAGGCTGG + Exonic
941481788 2:166024478-166024500 GGAAAACAAAACAAAAACCCAGG - Intronic
941581344 2:167300061-167300083 AAAATACAAAAGAAATAGCCAGG - Intergenic
941671583 2:168299585-168299607 AAAATACAAAAAAAATAGCCGGG - Intergenic
941844943 2:170123030-170123052 AGAACTCAAAACCAACAGCCTGG + Intergenic
941944201 2:171076751-171076773 AAAATACAAAAAAATCAGCCAGG + Intronic
942418349 2:175782035-175782057 ACAAAACAAAACAAAAAGCCTGG - Intergenic
942721078 2:178953274-178953296 AAAATACAAAACAATTAGCCGGG + Intronic
942788722 2:179733620-179733642 AAAATACAAAACAATTAGCCGGG + Intronic
942948834 2:181699939-181699961 TGAAAAAAAAAAAAAGAGCCTGG + Intergenic
943064634 2:183072721-183072743 AAAATACAAAAAAAATAGCCAGG + Intergenic
943487941 2:188511411-188511433 TGAATAGAAAACCAAAAGCATGG - Intronic
943531518 2:189087611-189087633 AAAATACAAAACAATTAGCCGGG - Intronic
943585258 2:189731665-189731687 AGATTAAAAAAGAAACAGCCTGG - Intronic
944088277 2:195874600-195874622 TAAAAAAAAAAAAAACAGCCTGG + Intronic
944719382 2:202407606-202407628 AAAATACAAAAAAATCAGCCAGG + Intronic
944845744 2:203666102-203666124 ACAATACAAAAAAATCAGCCGGG + Intergenic
945068529 2:205968016-205968038 TGAAGACAAAACAGCAAGCCGGG + Intergenic
945083510 2:206109175-206109197 AAAATACAAAACAATTAGCCGGG - Intergenic
945083664 2:206110174-206110196 AAAATACAAAACAATTAGCCAGG + Intergenic
945160168 2:206882348-206882370 TGTATAAAAAAATAACAGCCAGG - Intergenic
945246494 2:207722231-207722253 AAAATACAAAAAAATCAGCCAGG - Intronic
945413826 2:209545980-209546002 AAAATACAAAACAATTAGCCAGG + Intronic
945925908 2:215804374-215804396 AAAATACAAAAAAATCAGCCAGG + Intergenic
946102981 2:217343002-217343024 TAAATACAAAAAAATTAGCCGGG + Intronic
946274505 2:218620731-218620753 TGAACAAACAAAAAACAGCCAGG + Intronic
946503945 2:220279129-220279151 AAAATACAAAAAAAATAGCCAGG + Intergenic
946556971 2:220869381-220869403 TAAATACAAAAAAATTAGCCAGG - Intergenic
946677878 2:222181767-222181789 TTAAAAAAAAACAAACAGGCCGG + Intergenic
946704139 2:222440634-222440656 TTAAAACATAAAAAACAGCCAGG - Intronic
946914145 2:224499019-224499041 TGAATACTCAACAAAGATCCAGG + Intronic
946935689 2:224718232-224718254 AAAATACAAAAAAAATAGCCAGG - Intergenic
947007899 2:225533526-225533548 AAAATACAAAACAAATAGCTGGG + Intronic
947173626 2:227338065-227338087 TTGAAACAAAACAAACATCCAGG + Intronic
947229956 2:227874800-227874822 AAAATACAAAACAATTAGCCAGG + Intronic
947337647 2:229103735-229103757 AAAATACAAAACAATTAGCCGGG - Intronic
947481888 2:230508474-230508496 AAAATACAAAAAAAATAGCCGGG - Intronic
947725150 2:232393543-232393565 AAAATACAAAACAATTAGCCGGG - Intergenic
948115325 2:235491172-235491194 AAAATACAAAAAAATCAGCCGGG - Intergenic
948507393 2:238438358-238438380 AAAATACAAAAAAAATAGCCGGG - Intronic
948548699 2:238752958-238752980 AAAATACAAAAAAATCAGCCGGG - Intergenic
948973902 2:241450789-241450811 AAAATACAAAACAATTAGCCAGG + Intronic
948998179 2:241595171-241595193 AGAATACAAAAAAATTAGCCAGG - Intronic
1168809634 20:696336-696358 AAAATACAAAAAAAATAGCCGGG - Intergenic
1168974552 20:1954367-1954389 AAAATACAAAAAAATCAGCCGGG - Intergenic
1168988552 20:2073211-2073233 AAAATACAAAAAAAATAGCCAGG + Intergenic
1169004169 20:2193122-2193144 TGAATATATAAGAAACAGGCCGG + Intergenic
1169069674 20:2716366-2716388 AAAATACAAAAAAATCAGCCGGG + Intronic
1169180986 20:3566744-3566766 AAAATACAAAACAATTAGCCAGG + Intronic
1169233989 20:3913947-3913969 AAAATACAAAAAAAATAGCCGGG - Intronic
1169435140 20:5580563-5580585 CAAATACAAAAAAAATAGCCGGG + Intronic
1170019829 20:11825032-11825054 AAAATACAAAAAAAATAGCCGGG - Intergenic
1170178588 20:13501618-13501640 AGAATAGAAAACAAAAAGCAAGG + Intronic
1170224362 20:13975271-13975293 TTCATATAGAACAAACAGCCAGG - Intronic
1170548689 20:17456823-17456845 TGAAGACAAATCAAATTGCCAGG + Intronic
1170582216 20:17707738-17707760 TAAATACAAAAAAATTAGCCGGG - Intronic
1170842312 20:19933967-19933989 TAAATACAAAAAAATTAGCCAGG - Intronic
1170980531 20:21207869-21207891 AAAATACAAAAAAATCAGCCGGG - Intronic
1171462248 20:25304726-25304748 AAAATACAAAACAATTAGCCAGG - Intronic
1171871916 20:30535026-30535048 AAAATACAAAAAAATCAGCCGGG + Intergenic
1171976314 20:31596870-31596892 TGAATTAGAAATAAACAGCCTGG - Intergenic
1172065826 20:32219655-32219677 AAAATACAAAAAAATCAGCCGGG - Intronic
1172247567 20:33456460-33456482 TGAAAAAAAAAGAAAAAGCCTGG - Intergenic
1172527912 20:35611690-35611712 TGAATACATAACAACTGGCCAGG - Intergenic
1172535665 20:35671259-35671281 AGAATACAAAAAAATTAGCCTGG - Intronic
1173201171 20:40956106-40956128 AAAATACAAAAAAAATAGCCAGG + Intergenic
1173521605 20:43704172-43704194 AAAATACAAAAAAAATAGCCGGG - Intronic
1173541933 20:43860175-43860197 TAAATAGATAAGAAACAGCCAGG - Intergenic
1174027909 20:47594502-47594524 AAAATACAAAACAATTAGCCTGG + Intronic
1174402033 20:50281196-50281218 TGGATACAAAACAAAGCACCTGG - Intergenic
1174475220 20:50791425-50791447 TGAAAAAAAAAAAAAAAGCCTGG - Intergenic
1174748155 20:53085202-53085224 AAAATACAAAAAAATCAGCCGGG + Intronic
1175102132 20:56586860-56586882 AAAATACAAAACAATTAGCCGGG - Intergenic
1175110736 20:56646232-56646254 ACAAAACAAAACAAACAGTCTGG + Intergenic
1175308961 20:57998218-57998240 TCAATACAAAAGAAACAGACAGG + Intergenic
1175561845 20:59937659-59937681 GGAAAAAAAAAAAAACAGCCAGG - Exonic
1175783837 20:61699894-61699916 TGAGTACAAACCAAACAGTGAGG + Intronic
1176075419 20:63246086-63246108 AAAATACAAAACAATTAGCCGGG - Intronic
1176342537 21:5712072-5712094 AAAATACAAAACAATTAGCCGGG - Intergenic
1176474791 21:7144223-7144245 AAAATACAAAACAATTAGCCGGG - Intergenic
1176502290 21:7612384-7612406 AAAATACAAAACAATTAGCCGGG + Intergenic
1176536858 21:8110141-8110163 AAAATACAAAACAATTAGCCGGG - Intergenic
1177068364 21:16468571-16468593 AGAATACAAAAAAAGTAGCCAGG + Intergenic
1177376913 21:20282124-20282146 AAAATACAAAAAAAATAGCCAGG - Intergenic
1177413955 21:20770670-20770692 AAAATACAAAAAAAATAGCCAGG - Intergenic
1177545889 21:22558812-22558834 TGAAAATAAGACATACAGCCAGG - Intergenic
1177605370 21:23370801-23370823 AAAATACAAAAAAAATAGCCGGG + Intergenic
1177674955 21:24285000-24285022 TAAATACAAAAAAATTAGCCAGG + Intergenic
1177985588 21:27970896-27970918 TAAATACAAAAAAATTAGCCTGG - Intergenic
1178089035 21:29142223-29142245 AAAATACAAAACAATTAGCCGGG - Intronic
1178215894 21:30597843-30597865 AAAATACAAAAAAACCAGCCAGG - Intergenic
1178312464 21:31541085-31541107 TGAATACAGAACCCACATCCTGG + Intronic
1178325707 21:31643780-31643802 TGAATATAAGAAAACCAGCCTGG + Intergenic
1178800341 21:35788829-35788851 AAAATACAAAAAAAATAGCCGGG - Intronic
1179096348 21:38319179-38319201 AAAATACAAAAAAAACAGCCGGG + Intergenic
1179338500 21:40481327-40481349 AGAATACAAAAAAATTAGCCAGG + Intronic
1179497581 21:41783264-41783286 AAAATACAAAACAATTAGCCGGG - Intergenic
1179919778 21:44501434-44501456 AAAATACAAAACAATTAGCCAGG + Intronic
1179964978 21:44797995-44798017 TGAAGACAGAAAAATCAGCCAGG + Intronic
1180125869 21:45789977-45789999 AAAATACAAAAAAAATAGCCAGG + Intronic
1180332933 22:11549113-11549135 AAAATACAAAAAAAATAGCCAGG + Intergenic
1180474733 22:15692163-15692185 AAAATACAAAACAATTAGCCAGG - Intronic
1180692772 22:17731265-17731287 AAAATACAAAAAAAGCAGCCGGG - Intergenic
1180735481 22:18013222-18013244 TGAATGCAAAGCAAACAGCCAGG - Intronic
1181076165 22:20378398-20378420 TAAATGCAAAGCAAACAGCCAGG - Intronic
1181101632 22:20544504-20544526 AAAATACAAAACAACTAGCCAGG + Intronic
1181770935 22:25125052-25125074 TGAATACGAAACCAACAGTCAGG - Intronic
1181894930 22:26098814-26098836 AAAATACAAAAAAAAAAGCCAGG + Intergenic
1181995904 22:26882253-26882275 AAAATACAAAAAAATCAGCCAGG - Intergenic
1182014725 22:27030305-27030327 AAAATACAAAAAAAATAGCCGGG - Intergenic
1182140713 22:27955311-27955333 AAAATACAAAACAATTAGCCGGG - Intergenic
1182288530 22:29261813-29261835 AGAATACAAAATAATTAGCCAGG - Intronic
1182337353 22:29593076-29593098 TAAATACAAAAAAATTAGCCAGG - Intergenic
1182536053 22:31003755-31003777 AAAATACAAAACAATTAGCCGGG + Intergenic
1182635353 22:31722269-31722291 AAAATACAAAAAAATCAGCCGGG + Intronic
1182702527 22:32252067-32252089 AAAATACAAAAAAATCAGCCGGG + Intronic
1182891187 22:33820091-33820113 TGAGTGCAAAATAAACATCCCGG + Intronic
1183447312 22:37866623-37866645 AAAATACAAAAAAATCAGCCGGG + Intronic
1183480068 22:38058844-38058866 AAAATACAAAAAAATCAGCCAGG + Intronic
1183488611 22:38104654-38104676 AAAATACAAAACAATTAGCCGGG - Intronic
1183841966 22:40506071-40506093 AAAATACAAAAAAATCAGCCGGG + Intronic
1183855009 22:40626142-40626164 AAAATACAAAAAAATCAGCCGGG - Intronic
1183855079 22:40626696-40626718 TAAATACGAAACACAAAGCCAGG + Intronic
1183911413 22:41082260-41082282 AAAATACAAAAAAAATAGCCAGG + Intergenic
1183918372 22:41142723-41142745 AAAATACAAAACAATTAGCCGGG + Intronic
1183924137 22:41193687-41193709 AGAATACAAAAAAATGAGCCGGG + Intergenic
1183955171 22:41375588-41375610 TAAATACAAAAAAATTAGCCGGG + Intronic
1183962798 22:41422267-41422289 TAAATACAAAAAAATTAGCCAGG + Intergenic
1184165156 22:42722848-42722870 AAAATACAAAAAAATCAGCCAGG + Intergenic
1184226894 22:43134104-43134126 GGAATAAAAAGCAAACAGACTGG - Intronic
1184340565 22:43883648-43883670 AAAATACAAAACAATTAGCCGGG + Intronic
1184363752 22:44035529-44035551 AAAATACAAAAAAATCAGCCGGG - Intronic
1184393704 22:44220256-44220278 AAAATACAAAACAACTAGCCAGG - Intergenic
1184614712 22:45630260-45630282 AGAATACAAAAAAATTAGCCAGG + Intergenic
1184758168 22:46528766-46528788 AAAATACAAAAAAATCAGCCGGG + Intronic
1184882107 22:47314103-47314125 CAAATACAAAACAAATAGCAGGG - Intergenic
1185124112 22:48995435-48995457 AAAATACAAAAAAAATAGCCAGG + Intergenic
1185157363 22:49202196-49202218 AGAATACAAAAAAAAAAGCAGGG - Intergenic
1185298951 22:50069185-50069207 AAAATACAAAACAATTAGCCAGG - Intronic
1185370369 22:50458142-50458164 ACAATACAAAAAAATCAGCCGGG + Intronic
1185387616 22:50543217-50543239 AGAATACAAAAAAATTAGCCGGG - Intergenic
1203235455 22_KI270731v1_random:147730-147752 AAAATACAAAACAATTAGCCAGG - Intergenic
1203241805 22_KI270733v1_random:26547-26569 AAAATACAAAACAATTAGCCGGG - Intergenic
949135725 3:562627-562649 AAAATACAAAAAAATCAGCCAGG - Intergenic
950228716 3:11257397-11257419 AAAATACAAAAAAAATAGCCGGG + Intronic
950386693 3:12665612-12665634 AAAATACAAAACAAATAGGCCGG + Intergenic
950540950 3:13612539-13612561 AAAATACAAAAAAATCAGCCGGG - Intronic
950993743 3:17470759-17470781 AAAATACAAAAAAATCAGCCAGG + Intronic
951149680 3:19274360-19274382 TGAAAACAACACACACAGCAAGG - Intronic
951240919 3:20285364-20285386 AAAATACAAAACAATTAGCCAGG - Intergenic
951369063 3:21822230-21822252 TAAATACAAAAAAATTAGCCAGG - Intronic
951553225 3:23895972-23895994 AAAATACAAAAAAAATAGCCGGG + Intronic
951634073 3:24753966-24753988 TAAAAACAAAAAAAATAGCCAGG - Intergenic
951654572 3:24991280-24991302 AAAATACAAAACAATTAGCCAGG + Intergenic
951874275 3:27404205-27404227 TGAAAATAAAACAATTAGCCAGG + Intronic
952020256 3:29010031-29010053 AAAATACAAAAAAATCAGCCGGG + Intergenic
952061618 3:29517481-29517503 AAAATACAAAACAATTAGCCTGG - Intronic
952208521 3:31204877-31204899 AAAATACAAAACAATTAGCCAGG + Intergenic
952271616 3:31838348-31838370 AGAATACAAAAAAATTAGCCGGG + Intronic
952275971 3:31877062-31877084 AAAATACAAAAAAAATAGCCGGG - Intronic
952515576 3:34101498-34101520 TGAATGGAAAAAAAAAAGCCTGG - Intergenic
952591003 3:34953710-34953732 AAAATACAAAAGAATCAGCCTGG + Intergenic
953198290 3:40754392-40754414 TGAAATCACAACAAACAGTCTGG - Intergenic
953314803 3:41916866-41916888 TAAATACAAAAAAATTAGCCAGG - Intronic
953318467 3:41950399-41950421 AAAATACAAAAAAATCAGCCGGG - Intronic
953323524 3:41993139-41993161 AAAATACAAAACAATTAGCCGGG - Intergenic
953692423 3:45131025-45131047 TGAAAACAAAAAAATTAGCCAGG - Intronic
953952248 3:47200188-47200210 AGAATACAAAACAATTAGCCTGG + Intergenic
954029121 3:47805697-47805719 AAAATACAAAACAATCAGCTGGG - Intronic
954167612 3:48772799-48772821 AAAATACAAAAAAAATAGCCAGG - Intronic
954204543 3:49048625-49048647 AAAATACAAAAAAATCAGCCGGG + Intronic
954262793 3:49451825-49451847 ACAAAACAAAACAAAAAGCCAGG + Intergenic
954551215 3:51483138-51483160 TGAAAAAAAAAAAAAAAGCCAGG + Intronic
954974829 3:54683572-54683594 TGCATACAATACACACAGCATGG + Intronic
955364615 3:58300385-58300407 TTAAAAGAAATCAAACAGCCGGG + Intergenic
955545000 3:60018817-60018839 AAAATACAAAAAAAACAGCTGGG + Intronic
955685461 3:61544531-61544553 AGAATACAAAAAAATTAGCCAGG + Intergenic
956056620 3:65305415-65305437 AAAATACAAAAAAATCAGCCGGG + Intergenic
956184500 3:66549791-66549813 TTAATACAAAAAAAATAGCTGGG + Intergenic
956218152 3:66871818-66871840 AAAATACAAAAAAAATAGCCGGG + Intergenic
956399920 3:68866566-68866588 AGCAGACAAAACAAGCAGCCAGG + Intronic
956767756 3:72498314-72498336 AAAATACAAAAAAAATAGCCAGG - Intergenic
956819890 3:72944543-72944565 TACATAAAAAACAAACAGCTGGG - Intronic
956911796 3:73825851-73825873 TTAATACAAGCCAAACAGCAAGG - Intergenic
957343564 3:78931814-78931836 ACAAAACAAAACAAATAGCCTGG + Intronic
957821654 3:85384470-85384492 AGAATACAAAAAAATTAGCCGGG - Intronic
957829049 3:85491789-85491811 AAAATACAAAAAAAATAGCCGGG + Intronic
957890614 3:86352156-86352178 AAAATACAAAAAAATCAGCCAGG - Intergenic
957963584 3:87292834-87292856 TGAAGACACAAGAAACAGCATGG + Intergenic
957983674 3:87544954-87544976 TAAATACAAAAAAATTAGCCAGG + Intergenic
958005109 3:87800531-87800553 TAAATAAAATACAAACAGCATGG - Intergenic
958154635 3:89740625-89740647 TAAAATCAAAACAAACAACCTGG + Intergenic
958783888 3:98575909-98575931 TAAATACAAAAAAATTAGCCGGG + Intronic
958941362 3:100318947-100318969 GGATTGAAAAACAAACAGCCTGG - Intronic
958948390 3:100390666-100390688 AAAATACAAAACAATTAGCCAGG + Intronic
959212586 3:103406626-103406648 CGAATGCTAAACAAACAGCAAGG - Intergenic
959680483 3:109090457-109090479 AAAATACAAAACAATTAGCCTGG + Intronic
959710446 3:109380745-109380767 AAAATACAAAACAAATAGCCAGG - Intergenic
959737992 3:109683063-109683085 TAAAGACAAAACAAAAGGCCAGG + Intergenic
960230591 3:115221532-115221554 AAAATACAAAAAAAATAGCCAGG - Intergenic
960240067 3:115330554-115330576 GGAACACAAAACACACAGCCAGG - Intergenic
960292973 3:115908947-115908969 GGGATACAAGACAAACAGCAAGG - Intronic
960346149 3:116535724-116535746 TAAATACAAAAAAATTAGCCGGG - Intronic
960428759 3:117542981-117543003 AAAATACAAAAAAATCAGCCAGG - Intergenic
960446144 3:117751189-117751211 TGAATGTAAAACAAAGAGACTGG - Intergenic
960587783 3:119336012-119336034 AAAATACAAAAAAAATAGCCAGG + Intronic
960729585 3:120711487-120711509 TGTATAGAAAACAAACAGGGAGG - Intronic
960863601 3:122178591-122178613 AAAATACAAAAAAATCAGCCAGG - Intergenic
961183948 3:124898481-124898503 AAAATACAAAAAAAATAGCCAGG + Intronic
961438310 3:126934707-126934729 AAAATACAAAAAAATCAGCCAGG - Intronic
962885554 3:139622572-139622594 AAAATACAAAAAAATCAGCCAGG + Intronic
963179067 3:142334997-142335019 AAAATACAAAAAAATCAGCCAGG - Intronic
963360731 3:144269178-144269200 ATAATACAAAAAAAATAGCCAGG + Intergenic
963566612 3:146938711-146938733 AAAATACAAAAAAAACAGCTGGG + Intergenic
963796724 3:149638053-149638075 TAAATACAAAAAAATTAGCCAGG + Intronic
964110236 3:153079969-153079991 AAAATACAAAAAAATCAGCCAGG - Intergenic
964113056 3:153107062-153107084 AAAATACAAAAAAAATAGCCGGG - Intergenic
964262060 3:154850279-154850301 TAAATACAAAAAAATTAGCCAGG + Intergenic
964467148 3:157007039-157007061 AAAATACAAAAAAAATAGCCGGG + Intronic
964481466 3:157142828-157142850 TGAAAAAAAAAAAAAAAGCCGGG - Intergenic
964526565 3:157621226-157621248 AAAATACAAAAAAAACAGCCAGG + Intronic
964560091 3:157985306-157985328 TGAATACAAAACTCACAGGATGG - Intergenic
964639006 3:158888352-158888374 AAAATACAAAAAAAATAGCCAGG - Intergenic
965058301 3:163749773-163749795 AAAATACAAAAAAAATAGCCAGG - Intergenic
965530108 3:169763277-169763299 AAAATACAAAAAAATCAGCCGGG + Intergenic
965546896 3:169925564-169925586 AAAATACAAAAAAACCAGCCAGG + Intronic
965630819 3:170730783-170730805 AAAATACAAAACAATTAGCCGGG + Intronic
965724246 3:171697403-171697425 AAAATACAAAACAATTAGCCGGG - Intronic
965934471 3:174090310-174090332 AAAATACAAAAAAAATAGCCTGG + Intronic
965983594 3:174723593-174723615 AAAATACAAAACAATTAGCCGGG + Intronic
966155997 3:176917124-176917146 TGAATATAACAGAAACAGCTAGG - Intergenic
966259991 3:177965168-177965190 AAACTACAAAACAAACATCCTGG - Intergenic
966316534 3:178652821-178652843 TAAATACAAAAAAAATGGCCAGG - Intronic
966386967 3:179409349-179409371 AAAATACAAAAAAATCAGCCGGG + Intronic
966609779 3:181856884-181856906 AAAATACAAAAAAAATAGCCGGG + Intergenic
966766613 3:183468949-183468971 AAAATACAAAACAATTAGCCGGG + Intergenic
966813789 3:183872160-183872182 TAAATACAAAAAAATTAGCCAGG - Intronic
966999147 3:185315087-185315109 AGAATACAAAAAAATTAGCCAGG + Intronic
967014178 3:185466670-185466692 TAAAAAACAAACAAACAGCCGGG - Intronic
967024719 3:185554752-185554774 AAAATACAAAAAAATCAGCCGGG - Intergenic
967087830 3:186110073-186110095 TAAATGGAAAACAAGCAGCCCGG - Intronic
967193049 3:187001660-187001682 TGAAAAACAAACAAACGGCCGGG + Intronic
967333393 3:188316115-188316137 AAAATACAAAAAAACCAGCCAGG + Intronic
967363233 3:188656029-188656051 ATAATACAAAAAAAATAGCCAGG + Intronic
967729496 3:192894287-192894309 AAAATACAAAAAAATCAGCCAGG - Intronic
968015507 3:195328917-195328939 AAAATACAAAACAATTAGCCGGG + Intronic
968225931 3:196972080-196972102 AAAATACAAAAAAAATAGCCGGG - Intergenic
968259487 3:197308330-197308352 AAAATACAAAAAAAATAGCCGGG - Intergenic
968482492 4:842009-842031 AAAATACAAAACAAATAGCAAGG - Intergenic
968689378 4:1982819-1982841 TGAATACAAAACTCCCAGGCAGG + Exonic
968715329 4:2154035-2154057 AGAATACAAAAAAATTAGCCGGG + Intronic
968743655 4:2345049-2345071 AAAATACAAAAAAAATAGCCGGG + Intronic
968781021 4:2581412-2581434 AAAATACAAAAAAATCAGCCAGG - Intronic
968837895 4:2979062-2979084 TAAATACAAAAAAATTAGCCAGG + Intronic
969178751 4:5421248-5421270 AAAATACAAAAAAAATAGCCAGG - Intronic
969572448 4:8017445-8017467 AAAATACAAAAAAAATAGCCAGG - Intronic
970109043 4:12617233-12617255 AAAATACAAAAAAAATAGCCAGG - Intergenic
970184586 4:13436875-13436897 TGGAACCAAAAAAAACAGCCTGG + Intronic
970213330 4:13733182-13733204 AAAATACAAAATAAATAGCCGGG - Intergenic
970271542 4:14353487-14353509 TAAATACAAAAAAATTAGCCTGG - Intergenic
970467126 4:16335754-16335776 AAAATACAAAAAAAATAGCCAGG + Intergenic
970560970 4:17282061-17282083 AAAATACAAAAAAAAAAGCCAGG + Intergenic
970595338 4:17595197-17595219 TAAATACAAAAAAATTAGCCGGG - Intronic
970741168 4:19239345-19239367 TGAAGACAAAAGAAAAAGGCTGG + Intergenic
970807513 4:20053754-20053776 AAAATACAAAAAAAATAGCCAGG - Intergenic
970922896 4:21415795-21415817 TGGACACAAAACAAAGACCCTGG + Intronic
971019444 4:22518598-22518620 AAAATACAAAAAAATCAGCCAGG + Intergenic
971309381 4:25512084-25512106 AAAATACAAAACAATTAGCCGGG + Intergenic
971382625 4:26112910-26112932 AAAATACAAAACAATTAGCCGGG - Intergenic
971392140 4:26195887-26195909 AAAATACAAAACACACGGCCAGG - Intronic
971730990 4:30379648-30379670 AAAATACAAAAAAAATAGCCAGG - Intergenic
972026011 4:34378839-34378861 AAAATACAAAAAAAATAGCCAGG - Intergenic
972117343 4:35652821-35652843 ACAAAACAAAACAAAAAGCCAGG - Intergenic
972180745 4:36462410-36462432 AGAATACAAAAAAATTAGCCGGG - Intergenic
972351314 4:38238706-38238728 TGAATAAAAATGAAACAGGCCGG + Intergenic
972396497 4:38663653-38663675 TGCTTCCAAAACACACAGCCGGG - Intergenic
972546960 4:40089109-40089131 AAAATAGAAAACAATCAGCCAGG - Intronic
972588793 4:40464602-40464624 TGAAAATTAAACAATCAGCCAGG + Intronic
972605068 4:40606035-40606057 TTAAAAAAAAAAAAACAGCCGGG + Intronic
972714938 4:41636065-41636087 TAAAAACAAAAAAATCAGCCAGG - Intronic
972810219 4:42576313-42576335 AAAATACAAAAAAATCAGCCGGG + Intronic
973161724 4:47026354-47026376 GGAGAACAAAACAAACAACCCGG - Intronic
973266308 4:48214691-48214713 AAAATACAAAAAAAATAGCCAGG + Intronic
973750032 4:54006500-54006522 AAAATACAAAAAAAATAGCCGGG + Intronic
973921275 4:55687943-55687965 TGATTACATAACAAACAGTTTGG + Intergenic
974040004 4:56849045-56849067 AAAATACAAAAAAAATAGCCGGG + Intergenic
974167283 4:58219969-58219991 AAAATACAAAACAATTAGCCAGG + Intergenic
974508293 4:62806065-62806087 TGAAAACACAAAAAATAGCCAGG - Intergenic
974626614 4:64433957-64433979 AAAATACAAAACAATTAGCCAGG + Intergenic
975117280 4:70694005-70694027 TGAAAAAAAAAAAATCAGCCGGG + Intergenic
975121938 4:70738145-70738167 AAAATACAAAAGAAATAGCCAGG - Intronic
975138550 4:70897998-70898020 AAAATACAAAAAAATCAGCCAGG - Intergenic
975309856 4:72891556-72891578 AGAATACAGAACACAGAGCCTGG - Intergenic
975341776 4:73250440-73250462 AAAATACAAAACAATTAGCCAGG + Intronic
975545071 4:75551974-75551996 AGAATACAAAAAAATTAGCCAGG - Intergenic
975603043 4:76123671-76123693 AAAATACAAAAAAATCAGCCAGG - Intronic
975618418 4:76270811-76270833 TGAAAAATAAACAAACAGCATGG - Intronic
976165700 4:82252319-82252341 AAAATACAAAAAAAATAGCCAGG + Intergenic
976282291 4:83337067-83337089 AAAATACAAAACAATTAGCCGGG - Intergenic
976401126 4:84608332-84608354 AAAATACAAAACAATTAGCCGGG - Intronic
976401220 4:84609016-84609038 AAAATACAAAACAATTAGCCGGG + Intronic
976603982 4:86965389-86965411 TTAATCCAAACCAAACACCCTGG - Intronic
976868008 4:89754132-89754154 TGAATATCAAACAAATTGCCTGG + Intronic
977237538 4:94526891-94526913 AAAATACAAAAAAATCAGCCAGG - Intronic
977310708 4:95383649-95383671 TGAATAAAAAGTAAACAGCCTGG - Intronic
977451438 4:97203879-97203901 TCAATAAAAGACAAATAGCCTGG + Intronic
977550234 4:98434534-98434556 TGAATGCAAAACACACAGAAGGG - Intronic
977807480 4:101319169-101319191 TGAAAAAAAAAAAAAAAGCCTGG + Intronic
977940911 4:102857852-102857874 TAAATACAAAAAAATTAGCCAGG - Intronic
978071018 4:104469490-104469512 TGAATATAAAACACACAGTGAGG + Exonic
978444560 4:108768149-108768171 AAAATACAAAAAAATCAGCCAGG - Intergenic
978484165 4:109230976-109230998 TAAATACAAAAAAATTAGCCAGG + Intronic
978576173 4:110192027-110192049 TAAATACAAAAAAATCAGCCGGG + Intronic
978796203 4:112710535-112710557 TGAATACAAAAAAATTAGCTGGG + Intergenic
978965184 4:114732088-114732110 TAAATACAAAAAAATTAGCCAGG - Intergenic
979117330 4:116842755-116842777 CAAATACTAAACAAACATCCTGG - Intergenic
979245614 4:118500755-118500777 AAAATACAAAAAAAACAGCAGGG + Intergenic
979274622 4:118801099-118801121 AAAATACAAAAAAATCAGCCGGG + Intronic
979525078 4:121707801-121707823 AAAATACAAAAAAATCAGCCAGG - Intergenic
979539081 4:121858681-121858703 AGAAAACAAAACAAAAAGGCAGG + Intronic
979653824 4:123168002-123168024 TGAATATAAAACAATCAGTTTGG - Intronic
979870641 4:125815657-125815679 AAAATACAAAAAAAAAAGCCGGG + Intergenic
980087564 4:128407502-128407524 AAAATACAAAACAATTAGCCAGG - Intergenic
980314435 4:131178374-131178396 AAAATACAAAAAAATCAGCCGGG + Intergenic
980386780 4:132095929-132095951 TGAAAAGAAATCAAATAGCCTGG - Intergenic
980518347 4:133895676-133895698 TAAAAACAAAAAAAATAGCCAGG - Intergenic
980616554 4:135234333-135234355 AGAACACAAAACAAACAGAGTGG + Intergenic
980623340 4:135339845-135339867 AAAATACAAAAAAATCAGCCGGG - Intergenic
980914537 4:139021917-139021939 TAAATACAAAAAAATTAGCCGGG - Intronic
981196295 4:141924981-141925003 AAAATACAAAAAAATCAGCCGGG - Intergenic
981321768 4:143400099-143400121 AAAATACAAAACAATGAGCCAGG - Intronic
981463856 4:145043179-145043201 TTAATACAAAAAAAAGAGGCAGG + Intronic
981936568 4:150246203-150246225 AAAATACAAAAAAATCAGCCAGG - Intronic
982050619 4:151498085-151498107 TGAATACAAAAAACACAGATGGG - Intronic
982246838 4:153361675-153361697 AAAATACAAAAAAAATAGCCGGG + Intronic
982352252 4:154428740-154428762 AAAATACAAAAAAAATAGCCAGG + Intronic
982648987 4:158063407-158063429 TTAAAACAAAACAGACAACCTGG + Intergenic
982763363 4:159315603-159315625 TGGATACAAAACAAAGGGGCAGG + Intronic
982938170 4:161512994-161513016 AAACTACAAAACAAAAAGCCTGG + Intronic
983199237 4:164843127-164843149 AAAATACAAAACAATTAGCCAGG + Intergenic
983360955 4:166722582-166722604 AGAATATAAAATAATCAGCCGGG + Intergenic
983541812 4:168919362-168919384 AAAATACAAAAAAATCAGCCAGG + Intronic
983610778 4:169642677-169642699 AAAATACAAAACAATTAGCCAGG - Intronic
983650135 4:170028808-170028830 AAAATACAAAACAATTAGCCAGG + Intronic
983804873 4:171982456-171982478 AAAATACAAAAAAATCAGCCGGG - Intronic
984154170 4:176173808-176173830 TAAAAACATAACAAACGGCCAGG - Intronic
984259569 4:177428264-177428286 AAAATACAAAAAAATCAGCCAGG + Intergenic
984271125 4:177549737-177549759 AAAATACAAAAAAAATAGCCGGG + Intergenic
984674031 4:182526138-182526160 AAAATACAAAAAAATCAGCCGGG - Intronic
984686059 4:182669428-182669450 AGAATACAAAAAAATTAGCCCGG - Intronic
984693520 4:182755677-182755699 AAAATACAAAAAAAATAGCCGGG + Intronic
984707822 4:182860819-182860841 AAAATACAAAAAAAATAGCCGGG + Intergenic
985286160 4:188337939-188337961 AAAATACAAAAAAAATAGCCGGG + Intergenic
985304954 4:188529249-188529271 AAAATACAAAAAAAATAGCCAGG + Intergenic
986065188 5:4228232-4228254 AAAATACAAAAAAAATAGCCAGG + Intergenic
986794918 5:11200837-11200859 AAAATACAAAAAAAATAGCCGGG - Intronic
987372601 5:17207209-17207231 ACAATACAAAAAAATCAGCCGGG + Intronic
987550907 5:19380192-19380214 TGAAAAGTAAAAAAACAGCCAGG - Intergenic
987968827 5:24914984-24915006 TTAAAACAAAAGAAAAAGCCAGG - Intergenic
988247275 5:28703003-28703025 AAAATACAAAAAAATCAGCCAGG + Intergenic
988321884 5:29709042-29709064 AAAATACAAAAAAAATAGCCAGG - Intergenic
989040307 5:37220678-37220700 AAAATACAAAAAAATCAGCCAGG - Intronic
989219280 5:38937191-38937213 AAAATACAAAAAAATCAGCCGGG - Intronic
989490931 5:42052418-42052440 TAAAAACAAAAGAAACAGCAAGG + Intergenic
989717473 5:44481281-44481303 AAAATACAAAAAAATCAGCCAGG + Intergenic
989990902 5:50764556-50764578 TGAATAGAACAGAGACAGCCTGG - Intronic
990015024 5:51050139-51050161 TGACAGCAAAACAAAAAGCCAGG + Intergenic
990125201 5:52508259-52508281 TAAAAACACAAAAAACAGCCAGG + Intergenic
990195887 5:53315820-53315842 TGAACAGAAAACAAATAGCAAGG + Intergenic
990450196 5:55926304-55926326 AAAAAACAAAACAATCAGCCGGG - Intergenic
990557210 5:56949195-56949217 AAAATACAAAAAAATCAGCCAGG + Intronic
990690007 5:58353383-58353405 AAAATACAAAAAAAATAGCCGGG - Intergenic
990754165 5:59049966-59049988 TTAAGAAAAAACACACAGCCGGG + Intronic
990959096 5:61374712-61374734 AAAATACAAAAAAATCAGCCGGG - Intronic
991304630 5:65163999-65164021 TGAATAAAAAACAGACAGAGGGG + Intronic
991308344 5:65206537-65206559 AAAATACAAAAAAATCAGCCGGG + Intronic
991772180 5:70050560-70050582 TTAAAACAAAATAAACGGCCGGG + Intronic
991851473 5:70925978-70926000 TTAAAACAAAATAAACGGCCGGG + Intronic
991921956 5:71665933-71665955 AAAATACAAAAAAAATAGCCAGG - Intergenic
992241501 5:74774441-74774463 AAAATACAAAAAAATCAGCCGGG + Intronic
992241611 5:74775454-74775476 AAAATACAAAACAATTAGCCAGG + Intronic
992255970 5:74921547-74921569 TAAATACAAAAAAATTAGCCAGG - Intergenic
992388710 5:76310910-76310932 GGAATACAAAAAAACTAGCCTGG + Intronic
992449752 5:76865403-76865425 AAAATACAAAAAAAATAGCCAGG - Intronic
992687571 5:79213344-79213366 ACAATACAAAAAAAATAGCCGGG + Intronic
993031745 5:82714270-82714292 AAAATACAAAAAAAATAGCCAGG + Intergenic
993148726 5:84132072-84132094 AAAATACAAAAAAAATAGCCTGG + Intronic
993170183 5:84409583-84409605 AAAATACAAAAAAATCAGCCAGG + Intergenic
993188330 5:84648322-84648344 AAAATACAAAAAAAATAGCCGGG + Intergenic
993498582 5:88637658-88637680 TAAATACAAAAAAAATAGCCGGG + Intergenic
993594463 5:89835280-89835302 TAAATACAAAAAAATTAGCCTGG - Intergenic
993645432 5:90455459-90455481 TTAATATACAACAAAAAGCCGGG - Intergenic
994012374 5:94920579-94920601 ACAATACAAAAAAATCAGCCAGG + Intronic
994217096 5:97150283-97150305 TCAAAACAAAACAAAAACCCAGG + Intronic
994258560 5:97630177-97630199 AAAATACAAAAAAAATAGCCGGG - Intergenic
994414246 5:99448113-99448135 TGAATAAAAAACAAAAAAACAGG + Intergenic
994661349 5:102658083-102658105 TAAATACAAAAAAATTAGCCAGG + Intergenic
994868569 5:105313844-105313866 AAAATACAAAACAATTAGCCAGG + Intergenic
994894995 5:105691999-105692021 AAAATACAAAAAAAATAGCCAGG - Intergenic
994920634 5:106038702-106038724 AAAATACAAAAAAATCAGCCAGG - Intergenic
995082951 5:108075473-108075495 TCAAAACAAAACAAACAACACGG - Intronic
995143075 5:108755644-108755666 TAAATACAAAAAAATTAGCCGGG - Intronic
995152317 5:108863278-108863300 AAAATACAAAACAAGTAGCCAGG - Intronic
995279922 5:110322513-110322535 AAAATACAAAAAAAATAGCCAGG + Intronic
995442157 5:112203876-112203898 AAAATACAAAAAAATCAGCCGGG + Intronic
995507461 5:112874934-112874956 TAAATACAAAAAAATTAGCCGGG - Intronic
996106272 5:119507621-119507643 AAAATACAAAAAAAAAAGCCGGG + Intronic
996400326 5:123055119-123055141 AAAATACAAAAAAATCAGCCGGG + Intergenic
996408611 5:123130723-123130745 AAAATACAAAACAATTAGCCGGG - Intronic
996683575 5:126255589-126255611 TGTATAAAAAACAAACTGCGTGG + Intergenic
996851066 5:127952739-127952761 TTAAAACAAAACAAAATGCCAGG - Intergenic
996939185 5:128983451-128983473 AGAATACAAAAAAAATAGCCAGG - Intronic
997073613 5:130645817-130645839 AAAATACAAAACAATTAGCCAGG - Intergenic
997095159 5:130902270-130902292 TGACTTCAAACCAAACAGCATGG + Intergenic
997461528 5:134055721-134055743 TAAAAACAAAATAAGCAGCCGGG - Intergenic
997895240 5:137710102-137710124 TGAAGACAAATGAAGCAGCCTGG - Intronic
997919392 5:137964217-137964239 AAAATACAAAACAATTAGCCAGG - Intronic
997951801 5:138248259-138248281 AAAATACAAAAAAATCAGCCAGG + Intergenic
997971151 5:138403378-138403400 AGAATAGAAAAGAACCAGCCTGG + Intronic
998021321 5:138773869-138773891 CAAAAACAAAACAATCAGCCAGG - Intronic
998022304 5:138779923-138779945 AAAAAACAAAACAACCAGCCTGG - Intronic
998074005 5:139221444-139221466 ACAAAACAAAACAAAAAGCCAGG + Intronic
998237585 5:140412323-140412345 TAACTACAAAAAAAATAGCCGGG - Intronic
998309821 5:141117389-141117411 AAAATACAAAAAAAATAGCCGGG + Intronic
998639251 5:143990939-143990961 TGAAAACACAACAATTAGCCAGG + Intergenic
999230687 5:150060164-150060186 AAAATACAAAAAAATCAGCCGGG + Intronic
999538457 5:152545201-152545223 AAAATACAAAACAATTAGCCGGG + Intergenic
999651528 5:153772615-153772637 TGAAGACAAATCAAATGGCCTGG + Intronic
999797218 5:155000224-155000246 AAAATACAAAAAAATCAGCCAGG - Intergenic
999893669 5:156005743-156005765 TTAAAACAAAACAAAAGGCCGGG - Intronic
999926457 5:156383998-156384020 TGAACACAATTTAAACAGCCTGG - Intronic
1000067421 5:157706808-157706830 TAAATAAAAGAAAAACAGCCGGG + Intergenic
1000329651 5:160196731-160196753 AAAATACAAAACAATTAGCCGGG - Intronic
1000344699 5:160304972-160304994 AAAATACAAAAAAAATAGCCGGG - Intronic
1000483528 5:161809839-161809861 TGAAAACACAAAAAATAGCCGGG - Intergenic
1000786116 5:165545837-165545859 AAAATACAAAAAAAATAGCCTGG + Intergenic
1000799598 5:165708574-165708596 GTAATACAAAACAAATAGCTTGG + Intergenic
1000803641 5:165760492-165760514 AAAATACAAAACAATTAGCCAGG + Intergenic
1000875470 5:166632401-166632423 AAAATACAAAAAAATCAGCCAGG - Intergenic
1001124916 5:169010740-169010762 AAAATACAAAACAATTAGCCAGG + Intronic
1001409557 5:171501015-171501037 AAAATACAAAAAAAATAGCCTGG - Intergenic
1001510431 5:172316998-172317020 AAAATACAAAAAAAATAGCCGGG + Intergenic
1001800288 5:174537762-174537784 AGAATACAAAAAAATTAGCCAGG - Intergenic
1001839820 5:174865449-174865471 TGAATACAAAAAAATTAGCTGGG - Intergenic
1002143523 5:177160459-177160481 AAAATACAAAAAAATCAGCCGGG - Intronic
1002275538 5:178102218-178102240 TTAAAACAAAAAAATCAGCCAGG + Intergenic
1002369176 5:178736936-178736958 AAAATACAAAAAAATCAGCCGGG - Intergenic
1002601388 5:180355758-180355780 TCAAAACAAAACAAAAATCCAGG + Intergenic
1002635728 5:180607478-180607500 AAAATACAAAACAATTAGCCGGG + Intronic
1002639578 5:180624385-180624407 AAAATACAAAAAAAATAGCCAGG - Intronic
1002741551 5:181438302-181438324 TGCATAGAAAACAAACACTCTGG + Intergenic
1003212981 6:4083710-4083732 TAAATACAAAAAAATTAGCCAGG - Intronic
1003276411 6:4657260-4657282 TGAAGACAAAAAAATCAGCAAGG + Intergenic
1003422404 6:5970193-5970215 TGAATACAGAAGAAACAGGATGG - Intergenic
1003960641 6:11205786-11205808 TAAATACAAAAAAATTAGCCAGG - Intronic
1004129367 6:12904371-12904393 AAAATACAAAAAAAATAGCCAGG + Intronic
1004501197 6:16211608-16211630 AAAATACAAAAAAAATAGCCAGG + Intergenic
1004515303 6:16317483-16317505 TAAATACAAAAAAATTAGCCTGG - Intronic
1004564182 6:16780222-16780244 AAAATACAAAACAATTAGCCAGG - Intergenic
1004862328 6:19817465-19817487 GCAATAGAAAACAACCAGCCAGG - Intergenic
1004936672 6:20514872-20514894 AAAATACAAAAAAATCAGCCAGG - Intergenic
1005034798 6:21545598-21545620 TAAATACAAAAAAATTAGCCGGG + Intergenic
1005383728 6:25264413-25264435 TGAAGACAAAACAAGAAGGCAGG + Intergenic
1005604678 6:27464578-27464600 CAAATAGAAAACAAACAGCAAGG + Intronic
1005793205 6:29328739-29328761 AGAATACAAAAAAATTAGCCAGG - Intergenic
1006286206 6:33096423-33096445 AAAATACAAAACAATTAGCCAGG + Intergenic
1006327228 6:33363558-33363580 TAAAAACAAAACAAGCGGCCAGG + Intergenic
1006605603 6:35254696-35254718 AAAAAAAAAAACAAACAGCCGGG + Intergenic
1007452001 6:41947233-41947255 AGAAAAGAAAAGAAACAGCCTGG + Intronic
1007468794 6:42074693-42074715 AAAATACAAAAAAATCAGCCGGG - Intronic
1007539264 6:42625972-42625994 AAAATACAAAAAAAATAGCCAGG - Intronic
1007580011 6:42952327-42952349 TAAATACAAAAAAATTAGCCGGG + Intergenic
1007744820 6:44037152-44037174 AAAATACAAAAAAATCAGCCAGG + Intergenic
1008129264 6:47701997-47702019 TAAATACAAAAAAATGAGCCAGG - Intronic
1008288486 6:49683377-49683399 TTAATATAATAGAAACAGCCGGG + Intergenic
1008394255 6:50988747-50988769 AGAATACAAAAAAATTAGCCAGG + Intergenic
1008433551 6:51448773-51448795 TAAATACAAAAAAAAAAGCTTGG - Intergenic
1008446087 6:51593289-51593311 TAAACACAAAATAAACAGCAAGG - Intergenic
1009034329 6:58098135-58098157 TAAATACAAAAAAAATAGCTGGG + Intergenic
1009260474 6:61479791-61479813 TGGATACAAAACAAAAGGGCAGG - Intergenic
1009666168 6:66683901-66683923 AAAATACAAAAAAAATAGCCGGG + Intergenic
1009758366 6:67971240-67971262 TAAAAACAAAACAAAAAGACAGG + Intergenic
1009900770 6:69805463-69805485 TGAATAGAAAAAAAAATGCCAGG + Intergenic
1009933634 6:70206468-70206490 AAAATACAAAAAAAATAGCCAGG + Intronic
1010114750 6:72290393-72290415 ACAAAACAAAACAAACAGACAGG + Intronic
1010167627 6:72935615-72935637 TAAAAACAAAACAAACACCTTGG + Intronic
1010207500 6:73336021-73336043 AAAATACAAAAAAAATAGCCGGG + Intergenic
1010384190 6:75260243-75260265 AAAATACAAAAAAAATAGCCAGG + Intronic
1010422463 6:75690854-75690876 AAAATACAAAACAATTAGCCAGG - Intronic
1010762276 6:79737185-79737207 TGCTTACAAAACTAACAGACAGG + Intergenic
1010913991 6:81593192-81593214 AAAATACAAAAAAATCAGCCAGG + Intronic
1010969160 6:82246324-82246346 AAAATACAAAAAAATCAGCCAGG - Intronic
1011355100 6:86465795-86465817 TAAAAACAAAACAAAGAGACTGG + Intergenic
1011602241 6:89070460-89070482 AAAATACAAAAAAATCAGCCAGG + Intergenic
1011609474 6:89136515-89136537 AAAATACAAAAAAATCAGCCGGG + Intergenic
1011639420 6:89405191-89405213 AAAATACAAAAAAATCAGCCAGG + Intronic
1011976627 6:93309107-93309129 TAAATACAAAACAAATAGCTGGG - Intronic
1012164331 6:95929614-95929636 TAAATACAAAAAAATTAGCCAGG - Intergenic
1012213060 6:96547906-96547928 TGAATACAAGACATACTGGCAGG - Intronic
1012461444 6:99466174-99466196 AAAATACAAAACAATTAGCCAGG - Intronic
1012632864 6:101495343-101495365 AAAATACAAAACAATTAGCCAGG + Intronic
1012924705 6:105255432-105255454 AAAATACAAAAAAAATAGCCGGG - Intergenic
1012925114 6:105259692-105259714 AAAATACAAAAAAAATAGCCAGG + Intergenic
1013295989 6:108758899-108758921 TTAATACAAAAAAATTAGCCAGG - Intergenic
1013522928 6:110949105-110949127 AAAATACAAAAAAAATAGCCAGG + Intergenic
1013529473 6:111005789-111005811 CAAATACAAAACAATTAGCCAGG - Intronic
1013583371 6:111557588-111557610 AAAATACAAAAAAAATAGCCGGG - Exonic
1013747752 6:113366004-113366026 AAAATACAAAACAATTAGCCGGG + Intergenic
1013802394 6:113962801-113962823 AAAATACAAAAAAAAAAGCCAGG + Intronic
1014530805 6:122557053-122557075 AAAATACAAAAGAAATAGCCAGG + Intronic
1014782089 6:125575932-125575954 TAAATACAAAAAAATTAGCCGGG - Intergenic
1015402234 6:132799531-132799553 AAAATACAAAAAAATCAGCCAGG + Intergenic
1015450716 6:133363633-133363655 AAAATACAAAAAAAATAGCCAGG - Intronic
1015660027 6:135565527-135565549 AAAATACAAAACAATTAGCCGGG - Intergenic
1015796653 6:137019285-137019307 TAAATACAAAAAAATTAGCCAGG - Intronic
1016051004 6:139530053-139530075 AAAATACAAAAAAATCAGCCGGG + Intergenic
1016055440 6:139573470-139573492 TTAAAACAAAACAAAAAGACTGG + Intergenic
1016195637 6:141335484-141335506 TGAAAAAACAACAAATAGCCAGG - Intergenic
1016322280 6:142858750-142858772 AAAATACAAAAAAATCAGCCAGG - Intronic
1016652708 6:146481511-146481533 TTAAAAAAAAAAAAACAGCCAGG - Intergenic
1016765510 6:147788921-147788943 AGAATACAAAAAAATTAGCCGGG + Intergenic
1016787082 6:148022642-148022664 AAAATACAAAAAAATCAGCCGGG - Intergenic
1017045035 6:150338985-150339007 AAAATACAAAAAAAATAGCCTGG + Intergenic
1017126131 6:151066274-151066296 AAAATACAAAAAAATCAGCCTGG + Intronic
1017336203 6:153263312-153263334 ACAAAACAAAACAAACAGACTGG + Intergenic
1017350417 6:153434299-153434321 GAAATACAAAAAAATCAGCCAGG + Intergenic
1017486474 6:154906658-154906680 AAAATACAAAACAATTAGCCAGG + Intronic
1017557964 6:155593312-155593334 AGAATACAAAAAAATTAGCCGGG + Intergenic
1017711828 6:157176388-157176410 AGAAAACAAAACAAAAAACCAGG - Intronic
1017847805 6:158274614-158274636 AAAATACAAAAAAATCAGCCGGG + Intronic
1017857520 6:158363642-158363664 AAAATACAAAAAAAATAGCCCGG - Intronic
1017953296 6:159156864-159156886 AAAATACAAAAAAATCAGCCAGG - Intergenic
1018130531 6:160727941-160727963 TGAAAACAAAACAAAAAGAGAGG + Intronic
1018140226 6:160825490-160825512 AAAATACAAAACAATTAGCCGGG + Intergenic
1018164990 6:161084984-161085006 AAAATACAAAAAAAACAGCTGGG + Intronic
1018334013 6:162764902-162764924 AAAATACAAAAAAAATAGCCGGG - Intronic
1018435437 6:163754527-163754549 AAAATACAAAACAATTAGCCGGG - Intergenic
1018667401 6:166151136-166151158 TGAAAAACAAACAAACAGGCTGG - Intergenic
1019246687 6:170714067-170714089 TGCATAGAAAACAAACACTCTGG + Intergenic
1019267457 7:126154-126176 AAAATACAAAAAAATCAGCCGGG - Intergenic
1019393727 7:805126-805148 AAAATACAAAAAAATCAGCCAGG + Intergenic
1019466230 7:1190898-1190920 AAAATACAAAACAATTAGCCAGG + Intergenic
1019497504 7:1347336-1347358 TAAAAACACAAAAAACAGCCAGG - Intergenic
1019551484 7:1604990-1605012 TCAAAACAAAACAAAAAACCAGG + Intergenic
1019779996 7:2934040-2934062 AGAAAAGAAAAAAAACAGCCAGG - Intronic
1019984290 7:4643846-4643868 AAAATACAAAAAAAATAGCCGGG + Intergenic
1020073900 7:5244995-5245017 AAAATACAAAAAAATCAGCCGGG + Intergenic
1020134432 7:5579114-5579136 AGAATACAAAAAAATTAGCCGGG - Intergenic
1020139510 7:5604930-5604952 AAAATACAAAACAATTAGCCGGG - Intronic
1020195958 7:6039459-6039481 AAAATACAAAAAAATCAGCCAGG + Intronic
1020202350 7:6089691-6089713 TAAATACAAAAAAATTAGCCAGG - Intergenic
1020229067 7:6303530-6303552 AAAATACAAAAAAAATAGCCAGG + Intergenic
1020255407 7:6500462-6500484 TCAAAACAAAACAAAAATCCGGG + Intronic
1020907302 7:14079488-14079510 AAAATACAAAAAAATCAGCCAGG + Intergenic
1020913882 7:14167727-14167749 TGAAAACCAAACAAACATACTGG + Intronic
1020983401 7:15100612-15100634 AAAATACAAAACAATTAGCCGGG + Intergenic
1021059146 7:16088576-16088598 AAAATACAAAAAAAATAGCCAGG - Intergenic
1021275160 7:18641185-18641207 TGAATACAAAACACATGGACTGG - Intronic
1021369406 7:19822992-19823014 AAAATACAAAAAAATCAGCCGGG + Intergenic
1021412822 7:20347274-20347296 TCAAAACAAAACAAAACGCCTGG - Intronic
1021495240 7:21267139-21267161 AAAATACAAAAAAAATAGCCAGG - Intergenic
1021534364 7:21686424-21686446 AGAAGACAAAACAAATAGCAAGG - Intronic
1022275956 7:28855293-28855315 AAAATACAAAAAAAATAGCCGGG - Intergenic
1022953295 7:35358938-35358960 AAAATACAAAACAATTAGCCAGG + Intergenic
1022967628 7:35488029-35488051 AGAATAGAATACAAAGAGCCTGG + Intergenic
1022974131 7:35541884-35541906 TAAATACAAAAAAATTAGCCGGG + Intergenic
1023182551 7:37499691-37499713 AAAATACAAAACAATTAGCCGGG - Intergenic
1023368856 7:39491958-39491980 TGAATACAAGAGATACAGCCTGG + Intronic
1023447487 7:40246755-40246777 AAAATACAAAAAAAATAGCCAGG - Intronic
1023743496 7:43301712-43301734 AAAATACAAAACAATTAGCCAGG + Intronic
1023919044 7:44612854-44612876 AGAAAAGAAAAAAAACAGCCAGG - Intronic
1023991021 7:45128767-45128789 AAAATACAAAAAAATCAGCCGGG - Intergenic
1024185356 7:46943148-46943170 AAAATACAAAAAAAATAGCCAGG + Intergenic
1024332153 7:48166442-48166464 TGTATACTAACCAAACAGCATGG + Intergenic
1024549594 7:50551389-50551411 AAAATACAAAAAAAATAGCCGGG - Intronic
1024741981 7:52364160-52364182 AAAATACAAAAAAACCAGCCGGG + Intergenic
1024764999 7:52647408-52647430 TGAAAATAAAAAAAATAGCCTGG + Intergenic
1024966693 7:55028996-55029018 AAAATACAAAAAAAACAGCTGGG + Intronic
1025074934 7:55934663-55934685 AAAATACAAAAAACACAGCCAGG - Intronic
1025716455 7:63961788-63961810 TGAAAAGAAAAAAAATAGCCTGG - Intergenic
1025864456 7:65367531-65367553 AAAATACAAAAAAATCAGCCAGG + Intergenic
1025872341 7:65446786-65446808 TGGATACAAAACAAAGGGGCAGG + Intergenic
1025934347 7:66022781-66022803 AAAATACAAAACAATTAGCCAGG + Intergenic
1026064211 7:67055436-67055458 AAAATACAAAAAAATCAGCCTGG + Intronic
1026074503 7:67154079-67154101 AAAATACAAAAAAAATAGCCAGG - Intronic
1026076271 7:67172579-67172601 AAAATACAAAAAAAATAGCCAGG - Intronic
1026431262 7:70349652-70349674 TGAAGAAAAAAAAAAAAGCCTGG - Intronic
1026638014 7:72101122-72101144 AAAATACAAAACAATTAGCCAGG - Intronic
1026648061 7:72190058-72190080 ACAAAACAAAACAAACTGCCAGG + Intronic
1026700587 7:72639703-72639725 AAAATACAAAAAAAATAGCCAGG + Intronic
1026714138 7:72772005-72772027 AAAATACAAAAAAATCAGCCTGG - Intronic
1026838522 7:73654324-73654346 AAAATACAAAAAAATCAGCCAGG + Intergenic
1027155176 7:75762152-75762174 TAAATACAAAAAAATTAGCCGGG - Intergenic
1027225311 7:76240003-76240025 AAAATACAAAACAATTAGCCAGG + Intronic
1027284261 7:76632391-76632413 AAAATACAAAAAAAATAGCCAGG + Intergenic
1027486420 7:78767148-78767170 AAAATACAAAACAATTAGCCAGG - Intronic
1027518000 7:79166653-79166675 TAAATACAAAACAAACAAGGTGG + Intronic
1027671114 7:81100682-81100704 AAAATACAAAAAAAATAGCCGGG - Intergenic
1027759837 7:82263267-82263289 AAAATACAAAAAAATCAGCCAGG - Intronic
1027817075 7:82988993-82989015 AAAATACAAAAAAAATAGCCAGG - Intronic
1027851119 7:83453186-83453208 GGAATACAAAAAAATTAGCCAGG - Intronic
1028036282 7:85988234-85988256 AAAATACAAAAAAAATAGCCGGG - Intergenic
1028112604 7:86960409-86960431 AAAATACAAAAAAATCAGCCAGG - Intronic
1028136535 7:87229103-87229125 TGAAAAAAAAAAAAACAGCCAGG - Intergenic
1029001986 7:97164103-97164125 AAAATATAAAAAAAACAGCCAGG - Intronic
1029009462 7:97243457-97243479 AAAATACAAAACAATTAGCCAGG - Intergenic
1029138125 7:98389477-98389499 AAAATACAAAAAAATCAGCCGGG - Intronic
1029337251 7:99912369-99912391 AAAATACAAAAGAAATAGCCAGG + Intronic
1029370300 7:100145928-100145950 AAAATACAAAAAAAAAAGCCGGG + Intergenic
1029706178 7:102277433-102277455 TAAATACAAAAAAACTAGCCAGG + Intronic
1029725199 7:102398443-102398465 TAAAAATAAAACAATCAGCCAGG - Intronic
1029840796 7:103360951-103360973 AAAATACAAAACAATTAGCCGGG + Intronic
1030248078 7:107407735-107407757 TGAATACAAAACAAACAGCCAGG + Intronic
1030354551 7:108527596-108527618 TTAATACAACAAAAACAGCTAGG + Intronic
1030528957 7:110688358-110688380 TGACTACAAAACAGACAGCTAGG + Intronic
1030734325 7:113027509-113027531 AAAATACAAAACAATTAGCCAGG - Intergenic
1031448999 7:121890828-121890850 TGAAGAAAAAAAAAATAGCCAGG - Intronic
1031618660 7:123909776-123909798 AGAAAAGAAAACAAACGGCCGGG - Intergenic
1031694456 7:124832654-124832676 ACAATACGAAACAATCAGCCGGG + Intronic
1031750744 7:125569715-125569737 AAAATACAAAAATAACAGCCAGG - Intergenic
1031924918 7:127630036-127630058 AAAATACAAAACAATTAGCCAGG - Intergenic
1032137931 7:129298489-129298511 AGAAAACAAAACAAAAAACCAGG - Intronic
1032269981 7:130395974-130395996 TGAAAACAAAAGGAACACCCTGG - Exonic
1032527074 7:132586590-132586612 AAAATACAAAACAATTAGCCGGG + Intronic
1032528269 7:132596864-132596886 TGAAAAAAAAAAAAACAGCATGG + Intronic
1032573081 7:133021924-133021946 AAAATACAAAAAAATCAGCCGGG + Intronic
1032748995 7:134817573-134817595 TGAATAAACAACAAACAATCAGG - Intronic
1033091423 7:138389692-138389714 AAAATACAAAAAAATCAGCCGGG + Intergenic
1033259422 7:139829617-139829639 AGAATTAAAAGCAAACAGCCAGG + Intronic
1033411674 7:141123911-141123933 AGAATACAAAAAAAATAGCCAGG - Intronic
1033486652 7:141796457-141796479 TGAATACAAAAGAAACAAACAGG + Intergenic
1033494313 7:141878553-141878575 AAAATACAAAAAAATCAGCCAGG + Intergenic
1033696786 7:143796761-143796783 TGAAAAAAAAAAAAATAGCCAGG + Intergenic
1033738270 7:144246579-144246601 AGAATACAAAAAAATTAGCCGGG - Intergenic
1033744783 7:144304374-144304396 AGAATACAAAAAAATTAGCCGGG + Intergenic
1033975128 7:147091764-147091786 AAAATACAAAAAAAATAGCCGGG - Intronic
1034172990 7:149077465-149077487 AAAATACAAAACAATTAGCCAGG + Intronic
1034346951 7:150391870-150391892 AAAATACAAAACAATTAGCCGGG - Intronic
1034626770 7:152499479-152499501 AAAATACAAAAAAAAGAGCCAGG - Intergenic
1034728152 7:153359820-153359842 AAAATACAAAAAAAAAAGCCAGG - Intergenic
1034818873 7:154198470-154198492 AGAATACAAAAAAATGAGCCAGG - Intronic
1035215326 7:157362059-157362081 TAAATACAAAAAAAAAGGCCGGG - Intronic
1035324417 7:158055765-158055787 TGGATACAAAACAAAGGGGCAGG - Intronic
1035501453 8:93894-93916 TGCATAGAAAACAAACACTCTGG - Intergenic
1035846092 8:2866373-2866395 TGAATACAAAACAAAGATTGTGG - Intergenic
1035874263 8:3170366-3170388 AAAATACAAAACAATTAGCCAGG - Intronic
1036418306 8:8571492-8571514 TGCATAGAAAGCATACAGCCGGG + Intergenic
1036544084 8:9749633-9749655 TAAAAACAAAAAAAATAGCCAGG - Intronic
1036717581 8:11140735-11140757 AAAATACAAAACAATTAGCCAGG + Intronic
1036779552 8:11636059-11636081 AAAATACAAAAAAAATAGCCAGG + Intergenic
1036791201 8:11721462-11721484 GCAAAACAAAACCAACAGCCAGG - Intronic
1036993203 8:13624032-13624054 TGTAAACAAAACAAAAACCCAGG + Intergenic
1037195143 8:16179718-16179740 AAAATACAAAACAATTAGCCAGG + Intronic
1037197910 8:16214759-16214781 TGAATATAAAAAAAATTGCCAGG + Intronic
1037240442 8:16771388-16771410 AAGAAACAAAACAAACAGCCAGG + Intergenic
1037356578 8:18026416-18026438 AAAATACAAAAAAATCAGCCAGG - Intronic
1037752766 8:21693440-21693462 TGAAAACAAAGAAAACAGTCAGG + Intronic
1038283012 8:26182608-26182630 AAAATACAAAAAAATCAGCCAGG + Intergenic
1038593252 8:28860635-28860657 AAAATACAAAACAACCAGCCAGG - Intronic
1038622541 8:29157542-29157564 AGAATACAAAAAAATTAGCCAGG + Intronic
1038748026 8:30271059-30271081 AAAATACAAAACAATTAGCCAGG - Intergenic
1038876841 8:31559468-31559490 AGAATACAAAAAAATTAGCCAGG + Intergenic
1038905955 8:31903307-31903329 AAAATACAAAAAAAATAGCCAGG - Intronic
1038974894 8:32684034-32684056 TAAATACAAAAAAACTAGCCAGG + Intronic
1039050889 8:33492168-33492190 AAAATACAAAACAAACAGCCAGG - Intronic
1039061709 8:33577087-33577109 TCAAAACAAAATAAACAGCTAGG - Intergenic
1039101930 8:33950433-33950455 TAAAAACCAAACAAAAAGCCTGG - Intergenic
1039237075 8:35513387-35513409 TAAATGCAAAAAAATCAGCCAGG - Intronic
1039267194 8:35838686-35838708 TGGCTAAAAGACAAACAGCCTGG + Intergenic
1039282520 8:36001744-36001766 TGAAAAAAAAAAAAACAGCAAGG - Intergenic
1039611176 8:38920568-38920590 TGAAAAAAAAAAAAACGGCCAGG - Intronic
1039932091 8:42002349-42002371 ACAAAACAAAACAATCAGCCTGG + Intronic
1040360706 8:46661653-46661675 AAAATACAAAAAAAATAGCCAGG + Intergenic
1040429900 8:47329229-47329251 AAAATACAAAAAAATCAGCCGGG - Intronic
1040442736 8:47461604-47461626 TAATTAAAAAACAAACAGGCTGG - Intronic
1040493405 8:47945880-47945902 AAAATACAAAACAATTAGCCGGG - Intronic
1040707446 8:50146355-50146377 TAAATACAAAAAAATTAGCCAGG + Intronic
1040927388 8:52698848-52698870 AAAATACAAAACAATTAGCCGGG - Intronic
1040986373 8:53298194-53298216 AAAATACAAAAAAAATAGCCAGG + Intergenic
1041239434 8:55836874-55836896 TAAATACAAAAAAATTAGCCAGG + Intergenic
1041265409 8:56059656-56059678 AAAATACAAAACAATTAGCCAGG + Intergenic
1041291804 8:56315082-56315104 AAAATACAAAACAATTAGCCAGG + Intronic
1041325164 8:56655562-56655584 AAAATACAAAAAAATCAGCCAGG + Intergenic
1041378579 8:57227435-57227457 TAAATACAGGACAAAAAGCCTGG + Intergenic
1041472093 8:58222272-58222294 TGAATACAAAACAAATTACATGG - Intergenic
1041707160 8:60858766-60858788 AAAATACAAAACAATTAGCCAGG - Intronic
1042135170 8:65626047-65626069 AAAATACAAAACAATTAGCCGGG - Intronic
1042173227 8:66012564-66012586 AAAATACAAAAAAATCAGCCAGG + Intergenic
1042265383 8:66902957-66902979 TAAATACAAAATAATGAGCCAGG + Intronic
1042305205 8:67323959-67323981 AAAATACAAAAAAATCAGCCAGG - Intronic
1042398085 8:68314251-68314273 ACAAAACAAAACAAAAAGCCAGG - Intronic
1042524003 8:69745564-69745586 TAAATACCAAACAAACATACTGG + Intronic
1042588582 8:70371126-70371148 AAAATACAAAAAAATCAGCCGGG + Intronic
1042593485 8:70421395-70421417 AGAACACAAAACAATTAGCCAGG + Intergenic
1042616248 8:70653269-70653291 AAAATACAAAAAAAATAGCCAGG - Intronic
1043207372 8:77463114-77463136 TGAATAGAAAAAAAATAGGCAGG + Intergenic
1043548617 8:81343482-81343504 AAAATACAAAAAAATCAGCCTGG + Intergenic
1043698034 8:83245926-83245948 TAAATACAAAAAAATTAGCCGGG + Intergenic
1044153858 8:88818124-88818146 AAAATACAAAAAAATCAGCCGGG - Intergenic
1044226916 8:89729627-89729649 AAAATACAAAAAAATCAGCCGGG - Intergenic
1044369319 8:91390275-91390297 AAAATACAAAAAAAATAGCCGGG - Intronic
1044589896 8:93903985-93904007 AAAATACAAAACAATTAGCCAGG - Intronic
1044677801 8:94747346-94747368 TAAAAACAAAACAATCACCCAGG - Intronic
1044710583 8:95053784-95053806 AAAATACAAAAAAATCAGCCAGG - Intronic
1045192232 8:99894250-99894272 TTATTTCAATACAAACAGCCTGG - Intergenic
1045299823 8:100901322-100901344 AAAAAACAAAACAAATAGCCAGG + Intergenic
1045396589 8:101766735-101766757 AAAATACAAAACAATTAGCCAGG - Intronic
1045534889 8:103018505-103018527 TGAAAACCAAGCAAAGAGCCAGG - Intergenic
1045596448 8:103661662-103661684 AAAATACAAAAAAATCAGCCAGG - Intronic
1045620121 8:103967488-103967510 AAAAAACAAAACAAACAGGCTGG - Intronic
1045998442 8:108390953-108390975 TGAATAGAAACCAGAAAGCCAGG - Intronic
1046178225 8:110607199-110607221 TAAATACAAAAAAAAAACCCTGG - Intergenic
1046196296 8:110866909-110866931 AAAATACAAAACAATTAGCCAGG - Intergenic
1046299828 8:112273563-112273585 AAAATACAAAAAAAATAGCCAGG + Intronic
1046616080 8:116478738-116478760 TGAATTAAAAACAAACAGTGAGG + Intergenic
1046722483 8:117636313-117636335 AAAATACAAAACAATTAGCCAGG + Intergenic
1046952857 8:120034606-120034628 AAAATACAAAACAATTAGCCAGG - Intronic
1047044622 8:121038134-121038156 TAAAAACACAAAAAACAGCCAGG + Intergenic
1047426006 8:124747686-124747708 AAAATACAAAAAAATCAGCCGGG - Intergenic
1047552048 8:125884886-125884908 AAAATACAAAAAAAATAGCCGGG - Intergenic
1047575320 8:126147906-126147928 CAAATAGAAAACAAACAGCAAGG - Intergenic
1047748769 8:127864706-127864728 AAAATACAAAAAAAATAGCCGGG - Intergenic
1047964609 8:130036659-130036681 TAAATACAAAAAAATTAGCCGGG + Intergenic
1048125708 8:131633683-131633705 AAAATACAAAAAAAATAGCCAGG - Intergenic
1048152818 8:131910430-131910452 CAAATACAAAACAATTAGCCAGG - Intronic
1048298580 8:133234790-133234812 TGAAACCAAAACAAGCAGCTAGG + Intergenic
1048426172 8:134325954-134325976 AAAATACAAAACAATTAGCCAGG - Intergenic
1048526477 8:135207527-135207549 TGAATACAAAAAAATTAGCCAGG + Intergenic
1048586842 8:135782142-135782164 AGAAGACAAAACAAAAAGCTAGG - Intergenic
1048771241 8:137897842-137897864 AAAATACAAAAAAATCAGCCAGG - Intergenic
1048887591 8:138920816-138920838 AAAATACAAAAAAAATAGCCAGG + Intergenic
1049328309 8:142035735-142035757 AGAATACACAACACACAGCTGGG + Intergenic
1049715760 8:144090475-144090497 TCAAAACAAACAAAACAGCCAGG - Intergenic
1049908798 9:245363-245385 AAAATACAAAAAAATCAGCCAGG - Intronic
1049968872 9:803793-803815 AAAATACAAAAAAAATAGCCAGG - Intergenic
1049972021 9:829772-829794 ATAATACAAAAAAAATAGCCTGG - Intergenic
1049997572 9:1046722-1046744 AAAATACAAAAAAAATAGCCGGG - Intergenic
1050485100 9:6125878-6125900 AAAATACAAAAAAATCAGCCAGG + Intergenic
1050659966 9:7873967-7873989 AAAATACAAAACAATTAGCCAGG - Intronic
1051244201 9:15092722-15092744 AAAATACAAAAAAATCAGCCTGG + Intergenic
1051261241 9:15266917-15266939 AAAATACAAAAAAAATAGCCTGG + Intronic
1051385728 9:16506733-16506755 AAAAAACCAAACAAACAGCCTGG - Intronic
1051480266 9:17552007-17552029 AAAATACAAAAAAATCAGCCAGG + Intergenic
1051814573 9:21090191-21090213 AAAATACAAAAAAAATAGCCAGG - Intergenic
1051833530 9:21308824-21308846 TGAATATGACACAGACAGCCTGG + Intergenic
1052013115 9:23434246-23434268 AAAATACAAAAAAAATAGCCGGG + Intergenic
1052298845 9:26930741-26930763 TAAATACAAAAAAATTAGCCGGG - Intronic
1052747118 9:32451765-32451787 TAAATTACAAACAAACAGCCAGG + Exonic
1052918965 9:33947662-33947684 AAAATACAAAAAAATCAGCCAGG + Intronic
1052936654 9:34098926-34098948 AAAATACAAAAAAAATAGCCAGG - Intronic
1053127364 9:35593201-35593223 TAAATACAAAAAAATTAGCCGGG + Intergenic
1053155176 9:35773228-35773250 AAAATAAAAAACAAATAGCCAGG + Intergenic
1053194187 9:36102793-36102815 AAAATACAAAAAAATCAGCCAGG + Intronic
1053259446 9:36649324-36649346 AAAATACAAAAAAAATAGCCGGG + Intronic
1053378705 9:37630539-37630561 TAAAAATAAAAAAAACAGCCAGG - Intronic
1053585442 9:39453256-39453278 AAAATACAAAAAAATCAGCCAGG - Intergenic
1053595213 9:39553846-39553868 AAAATACAAAAAAATCAGCCGGG - Intergenic
1053853172 9:42310469-42310491 AAAATACAAAAAAATCAGCCGGG - Intergenic
1054571045 9:66811130-66811152 AAAATACAAAAAAATCAGCCGGG + Intergenic
1054580871 9:66911970-66911992 AAAATACAAAAAAATCAGCCAGG + Intronic
1054739709 9:68792637-68792659 AAAATACAAAACAATTAGCCAGG - Intronic
1055080400 9:72263009-72263031 AAAATACAAAAAAAATAGCCGGG + Intergenic
1055325426 9:75123259-75123281 AAAATACAAAAAAATCAGCCGGG + Intronic
1055357944 9:75456757-75456779 TGAATACAAGACAAGCAACAGGG - Intergenic
1055528269 9:77156964-77156986 AGAACACACAACAAAGAGCCAGG - Intergenic
1055611260 9:78027588-78027610 TAAATGCAAAAAAAATAGCCGGG + Intronic
1055718455 9:79144628-79144650 AAAATACAAAAAAAATAGCCAGG - Intergenic
1055934891 9:81595656-81595678 AAAATACAAAAAAATCAGCCGGG + Intronic
1056075998 9:83041019-83041041 TAAATACAAAAAAATTAGCCAGG - Intronic
1056357737 9:85819828-85819850 TAAATACAAAAAAATCAGTCAGG + Intergenic
1056648550 9:88436923-88436945 AAAATACAAAAAAAATAGCCGGG - Intronic
1057400117 9:94715863-94715885 AAAATACAAAACAATCAGCCGGG - Intergenic
1057728751 9:97590382-97590404 AAAATACAAAAAAAATAGCCAGG - Intronic
1057766195 9:97921581-97921603 AAAATACAAAAAAATCAGCCGGG - Intronic
1058023962 9:100119716-100119738 AAAATACAAAAAAATCAGCCAGG - Intronic
1058027364 9:100156419-100156441 AAAATACAAAAAAAATAGCCAGG - Intronic
1058122407 9:101153733-101153755 AAAATACAAAAAAAATAGCCAGG - Intronic
1058170946 9:101680612-101680634 AGAATAATAACCAAACAGCCAGG + Intronic
1058458813 9:105163576-105163598 AAAATACAAAAAAAATAGCCAGG - Intergenic
1058675913 9:107399850-107399872 AAAATACAAAAAAAATAGCCAGG + Intergenic
1058692871 9:107534134-107534156 AAAATACAAAAAAACCAGCCGGG + Intergenic
1058701307 9:107602650-107602672 TAAAAACAAAAAAAAAAGCCCGG + Intergenic
1059111649 9:111563664-111563686 AAAATACAAAACAATTAGCCGGG - Intronic
1059631639 9:116130490-116130512 AAAATACAAAACAATTAGCCAGG + Intergenic
1059716141 9:116915163-116915185 TGAATACAAAGCAAATATCTGGG + Intronic
1059868399 9:118544074-118544096 TGGAAACAAAACAAACAAACAGG + Intergenic
1060099783 9:120829552-120829574 AAAATACAAAACAATTAGCCAGG - Intronic
1060117377 9:120953082-120953104 AAAATACAAAAAAAATAGCCGGG - Intronic
1060157564 9:121330412-121330434 AAAATACAAAACAATTAGCCAGG + Intronic
1060380786 9:123169327-123169349 AAAATACAAAAAAATCAGCCAGG - Intronic
1060961972 9:127687463-127687485 AAAATACAAAACAATTAGCCAGG - Intronic
1061123417 9:128658459-128658481 TCAAAAAAAAACAAACAGGCTGG - Intergenic
1061158726 9:128881239-128881261 AAAATACAAAAAAATCAGCCGGG - Intronic
1061200051 9:129132791-129132813 AAAATACAAAACAATCAGCTGGG - Intronic
1061570088 9:131472635-131472657 AAAATACAAAAAAATCAGCCAGG - Intronic
1061937561 9:133866643-133866665 GGAATACAAAAAAATTAGCCGGG + Intronic
1062047221 9:134430044-134430066 AAAATACAAAAAAAATAGCCGGG - Intronic
1062155300 9:135044945-135044967 AAAATACAAAAAAATCAGCCAGG + Intergenic
1062588437 9:137261864-137261886 TGGATACAAGACAAAGAGGCAGG + Intronic
1062651118 9:137578322-137578344 AAAATACAAAACAATTAGCCGGG - Intronic
1062653877 9:137591949-137591971 AAAATACAAAAAAAAAAGCCGGG + Intergenic
1203458127 Un_GL000220v1:9623-9645 AAAATACAAAACAATTAGCCGGG - Intergenic
1203607463 Un_KI270748v1:69518-69540 TGCATAGAAAACAAACACTCTGG + Intergenic
1185483212 X:463553-463575 AAAATACAAAAAAATCAGCCAGG + Intergenic
1185530759 X:816573-816595 AAAATACAAAACAATTAGCCGGG + Intergenic
1185558096 X:1037151-1037173 AAAATACAAAAAAAATAGCCGGG - Intergenic
1185565114 X:1089074-1089096 AAAATACAAAAAAATCAGCCAGG + Intergenic
1185597039 X:1313549-1313571 AAAATACAAAAAAAAAAGCCAGG + Intergenic
1185665337 X:1761055-1761077 AAAATACAAAAAAAATAGCCAGG + Intergenic
1185731513 X:2465505-2465527 TGAAAAGAAAACAGACGGCCAGG + Intronic
1185763475 X:2706197-2706219 AAAATACAAAAAAATCAGCCGGG + Intronic
1185864404 X:3610319-3610341 AAAATACAAAACAATTAGCCTGG + Intronic
1185874393 X:3690569-3690591 TAAAAACACAAAAAACAGCCAGG + Intronic
1185935438 X:4251833-4251855 TGAATACAAAAAAATTAGCCAGG + Intergenic
1186105016 X:6196389-6196411 AAAATACAAAACAATTAGCCGGG + Intronic
1186116764 X:6311982-6312004 AAAATACAAAAAAATCAGCCAGG - Intergenic
1186489109 X:9957637-9957659 AAAATACAAAAAAATCAGCCAGG + Intergenic
1186664425 X:11703538-11703560 AGAAGACAAAAAAAAAAGCCCGG - Intergenic
1186778378 X:12888702-12888724 TGAAAACAATTTAAACAGCCAGG - Exonic
1187534169 X:20123103-20123125 TAAATACAAAAAAATTAGCCAGG - Intergenic
1187676628 X:21722742-21722764 TGATTAAAAATCAGACAGCCTGG + Intronic
1188212486 X:27442075-27442097 TGGATACAAAACAAAGGGGCAGG + Intergenic
1188407550 X:29830608-29830630 CAAATACAAAAAAATCAGCCAGG - Intronic
1188556125 X:31414173-31414195 TGAATACAAAAAAAACTAGCCGG - Intronic
1188782146 X:34298789-34298811 TGAATCTAAGACAAACAGACTGG - Intergenic
1189484268 X:41417084-41417106 AAAATACAAAAAAAATAGCCGGG + Intergenic
1189508886 X:41641193-41641215 TTAATTCAGAAAAAACAGCCTGG - Intronic
1189527704 X:41842410-41842432 ATAATACAAAAAAAATAGCCAGG + Intronic
1189688554 X:43591456-43591478 AAAATACAAAAAAAATAGCCGGG + Intergenic
1189737872 X:44089765-44089787 TGAATACAGAAAAAAGAGCAGGG - Intergenic
1189987301 X:46565175-46565197 TGAATACATAAGAAAAAGTCTGG + Intergenic
1190165533 X:48070450-48070472 CAAATACAAAAAAATCAGCCAGG + Intronic
1190505708 X:51124249-51124271 TGGATAAAAATCACACAGCCAGG + Intergenic
1190586131 X:51944512-51944534 AGAATACAAAAAAATTAGCCAGG - Intergenic
1190787224 X:53663350-53663372 TAAATACAAAAAAATTAGCCGGG + Intronic
1191638450 X:63403427-63403449 TAAATACAAAAAAATTAGCCAGG - Intergenic
1191784204 X:64899645-64899667 AGAATACAAAAAAAATAGCTGGG - Intergenic
1191788573 X:64944299-64944321 AAAATACAAAACAATTAGCCAGG - Intronic
1191834620 X:65451106-65451128 TAAATACAAAAAAATTAGCCAGG - Intronic
1192323827 X:70115123-70115145 CAAATACAAAACAAATAGCCAGG + Intergenic
1192427150 X:71087386-71087408 AAAATACAAAAAAAAAAGCCGGG + Intergenic
1192760648 X:74092607-74092629 AAAATACAAAAAAATCAGCCAGG + Intergenic
1192883347 X:75311328-75311350 AAAATACAAAAAAAATAGCCAGG - Intergenic
1192961427 X:76135487-76135509 AAAATACAAAAAAAATAGCCGGG - Intergenic
1192997748 X:76530254-76530276 AAAATACAAAAAAAAGAGCCAGG - Intergenic
1193016073 X:76735872-76735894 TGAAAACAAAACAAATAATCAGG + Intergenic
1193550836 X:82890879-82890901 AAAATACAAAAAAAATAGCCAGG + Intergenic
1193764366 X:85508317-85508339 AAAATACAAAAAAATCAGCCGGG - Intergenic
1193986459 X:88247006-88247028 TGAATACACAACACACAGAATGG - Intergenic
1194154083 X:90364766-90364788 TAAATACAAAAAAATTAGCCGGG - Intergenic
1194171530 X:90589977-90589999 TGAAGGCAAAACACACAACCTGG - Intergenic
1194637179 X:96360546-96360568 AAAATACAAAAAAAATAGCCAGG + Intergenic
1194729092 X:97433212-97433234 TTAATAAAAAACAAAAAGGCTGG + Intronic
1194851463 X:98874975-98874997 GGAAGAGAAAACAAGCAGCCTGG - Intergenic
1195083765 X:101394947-101394969 AAAATACAAAAAAATCAGCCGGG - Intronic
1195095474 X:101497395-101497417 AAAATACAAAAAAAAAAGCCAGG - Intronic
1195280141 X:103324840-103324862 TAATTATAAAACAAACATCCAGG + Intergenic
1195865787 X:109431536-109431558 AAAATACAAAAAAATCAGCCGGG + Intronic
1196351473 X:114735950-114735972 AAAATACAAAAAAAATAGCCAGG + Intronic
1196386638 X:115161191-115161213 AAAATACAAAAAAAATAGCCGGG + Intronic
1196519467 X:116655980-116656002 AAATTACAAAACAAAAAGCCTGG + Intergenic
1196676021 X:118420726-118420748 TGAAGGCAAAGCAAACAGCAGGG - Intronic
1196857221 X:119995639-119995661 AAAATACAAAAAAAATAGCCGGG + Intergenic
1196868970 X:120095199-120095221 AAAATACAAAAAAAATAGCCAGG + Intergenic
1198194743 X:134348903-134348925 AGAATACAAAAAAATTAGCCAGG + Intergenic
1198196351 X:134366733-134366755 TGAATAAAAAACAAAGACCTAGG + Intergenic
1198367399 X:135955413-135955435 AAAATACAAAAAAAATAGCCAGG - Intergenic
1198469133 X:136929804-136929826 AAAATACAAAAAAATCAGCCAGG - Intergenic
1198774816 X:140168428-140168450 AGAAAAGAAAAGAAACAGCCAGG - Intergenic
1198962052 X:142193650-142193672 AAAATACAAAAAAAATAGCCGGG + Intergenic
1199035313 X:143043334-143043356 AAAATACAAAACAATTAGCCAGG + Intergenic
1199045680 X:143168405-143168427 AAAATACAAAACAATTAGCCAGG - Intergenic
1199112236 X:143948549-143948571 AAAATACAAAACAATTAGCCAGG + Intergenic
1199370987 X:147047757-147047779 AAAATACAAAAAAAATAGCCGGG + Intergenic
1200299539 X:154958772-154958794 AAAATACAAAAAAAATAGCCGGG - Intronic
1200403272 Y:2781599-2781621 AAAATACAAAAAAATCAGCCGGG + Intergenic
1200517762 Y:4167728-4167750 TGAAGGCAAAACACACAACCTGG - Intergenic
1200518683 Y:4181716-4181738 AAAATACAAAACAATTAGCCAGG - Intergenic
1200654827 Y:5889108-5889130 AGAATACAAAAAAATTAGCCGGG + Intergenic
1200887732 Y:8286247-8286269 AGTATACAAAAAAAATAGCCTGG - Intergenic
1200951989 Y:8906502-8906524 AAAATACAAAAAAATCAGCCGGG - Intergenic
1201230102 Y:11856077-11856099 AAAATACAAAAAAAATAGCCAGG + Intergenic
1201373836 Y:13294897-13294919 AAAATACAAAAAAATCAGCCAGG + Intronic
1202097102 Y:21263286-21263308 AAAATACAAAAAAATCAGCCGGG + Intergenic
1202365265 Y:24157258-24157280 AAAATACAAAAAAAATAGCCGGG + Intergenic
1202505516 Y:25512864-25512886 AAAATACAAAAAAAATAGCCGGG - Intergenic